ID: 972918765

View in Genome Browser
Species Human (GRCh38)
Location 4:43911164-43911186
Sequence TACTCAGATTAACTTCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918763_972918765 6 Left 972918763 4:43911135-43911157 CCTAGATCACTGGCCTTCAACTC No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data
972918764_972918765 -7 Left 972918764 4:43911148-43911170 CCTTCAACTCGCTTAGTACTCAG No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data
972918759_972918765 14 Left 972918759 4:43911127-43911149 CCCCCACACCTAGATCACTGGCC No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data
972918761_972918765 12 Left 972918761 4:43911129-43911151 CCCACACCTAGATCACTGGCCTT No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data
972918762_972918765 11 Left 972918762 4:43911130-43911152 CCACACCTAGATCACTGGCCTTC No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data
972918760_972918765 13 Left 972918760 4:43911128-43911150 CCCCACACCTAGATCACTGGCCT No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918765 Original CRISPR TACTCAGATTAACTTCTGTA TGG Intergenic
No off target data available for this crispr