ID: 972920914 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:43940409-43940431 |
Sequence | CTAGGTTTGCTCATTACTAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972920911_972920914 | 27 | Left | 972920911 | 4:43940359-43940381 | CCCTGGTTCTTTTTATTCGGGAA | No data | ||
Right | 972920914 | 4:43940409-43940431 | CTAGGTTTGCTCATTACTACTGG | No data | ||||
972920912_972920914 | 26 | Left | 972920912 | 4:43940360-43940382 | CCTGGTTCTTTTTATTCGGGAAG | No data | ||
Right | 972920914 | 4:43940409-43940431 | CTAGGTTTGCTCATTACTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972920914 | Original CRISPR | CTAGGTTTGCTCATTACTAC TGG | Intergenic | ||