ID: 972920914

View in Genome Browser
Species Human (GRCh38)
Location 4:43940409-43940431
Sequence CTAGGTTTGCTCATTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972920911_972920914 27 Left 972920911 4:43940359-43940381 CCCTGGTTCTTTTTATTCGGGAA No data
Right 972920914 4:43940409-43940431 CTAGGTTTGCTCATTACTACTGG No data
972920912_972920914 26 Left 972920912 4:43940360-43940382 CCTGGTTCTTTTTATTCGGGAAG No data
Right 972920914 4:43940409-43940431 CTAGGTTTGCTCATTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972920914 Original CRISPR CTAGGTTTGCTCATTACTAC TGG Intergenic