ID: 972922465

View in Genome Browser
Species Human (GRCh38)
Location 4:43960641-43960663
Sequence TTGGTCAGTGAGTAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972922458_972922465 -7 Left 972922458 4:43960625-43960647 CCAAGAGGTTGTCCATTTGGTCA No data
Right 972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG No data
972922456_972922465 -1 Left 972922456 4:43960619-43960641 CCTTGGCCAAGAGGTTGTCCATT No data
Right 972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972922465 Original CRISPR TTGGTCAGTGAGTAGGTGGG GGG Intergenic
No off target data available for this crispr