ID: 972922817

View in Genome Browser
Species Human (GRCh38)
Location 4:43965303-43965325
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972922815_972922817 -5 Left 972922815 4:43965285-43965307 CCTTAGGAGGACAAAGTGAGCTC No data
Right 972922817 4:43965303-43965325 AGCTCCCTTAAGCACCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr