ID: 972928937

View in Genome Browser
Species Human (GRCh38)
Location 4:44047460-44047482
Sequence CTATAGACAATATTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972928933_972928937 3 Left 972928933 4:44047434-44047456 CCAGGTTTGCCCAATGTGAGACT No data
Right 972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG No data
972928935_972928937 -7 Left 972928935 4:44047444-44047466 CCAATGTGAGACTTGTCTATAGA No data
Right 972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG No data
972928934_972928937 -6 Left 972928934 4:44047443-44047465 CCCAATGTGAGACTTGTCTATAG No data
Right 972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG No data
972928932_972928937 4 Left 972928932 4:44047433-44047455 CCCAGGTTTGCCCAATGTGAGAC No data
Right 972928937 4:44047460-44047482 CTATAGACAATATTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972928937 Original CRISPR CTATAGACAATATTGGAGCT TGG Intergenic
No off target data available for this crispr