ID: 972937348

View in Genome Browser
Species Human (GRCh38)
Location 4:44153948-44153970
Sequence TAGAACATGGTGCAGTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972937345_972937348 8 Left 972937345 4:44153917-44153939 CCATCAGTAAATTATGACATACC No data
Right 972937348 4:44153948-44153970 TAGAACATGGTGCAGTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972937348 Original CRISPR TAGAACATGGTGCAGTCATA AGG Intergenic
No off target data available for this crispr