ID: 972942092

View in Genome Browser
Species Human (GRCh38)
Location 4:44208326-44208348
Sequence ACTATGAAGGACCAACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972942089_972942092 -8 Left 972942089 4:44208311-44208333 CCTGTGTATCCTGGCACTATGAA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 972942092 4:44208326-44208348 ACTATGAAGGACCAACTAGCAGG No data
972942085_972942092 20 Left 972942085 4:44208283-44208305 CCAATTGGTGTCACATCTAACAT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 972942092 4:44208326-44208348 ACTATGAAGGACCAACTAGCAGG No data
972942087_972942092 -6 Left 972942087 4:44208309-44208331 CCCCTGTGTATCCTGGCACTATG 0: 1
1: 0
2: 1
3: 9
4: 148
Right 972942092 4:44208326-44208348 ACTATGAAGGACCAACTAGCAGG No data
972942088_972942092 -7 Left 972942088 4:44208310-44208332 CCCTGTGTATCCTGGCACTATGA 0: 1
1: 0
2: 0
3: 5
4: 101
Right 972942092 4:44208326-44208348 ACTATGAAGGACCAACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972942092 Original CRISPR ACTATGAAGGACCAACTAGC AGG Intronic