ID: 972942143

View in Genome Browser
Species Human (GRCh38)
Location 4:44208921-44208943
Sequence ATCTAAATCTGTAGGTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972942139_972942143 26 Left 972942139 4:44208872-44208894 CCAGAAAGAGGAAATTACAAAAC 0: 1
1: 0
2: 4
3: 24
4: 465
Right 972942143 4:44208921-44208943 ATCTAAATCTGTAGGTAATAAGG 0: 1
1: 0
2: 1
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972942143 Original CRISPR ATCTAAATCTGTAGGTAATA AGG Intronic
902951744 1:19889392-19889414 GTCTAAATGTGTAGGAAAAAAGG - Intronic
906592035 1:47034133-47034155 ACTTGAATATGTAGGTAATATGG + Intronic
909783099 1:79574039-79574061 ATCAAAATATGCAGGGAATATGG + Intergenic
911552101 1:99295292-99295314 ATTTACTTCTGTAGGGAATATGG - Intronic
911588311 1:99716618-99716640 ATATAAATTTGTAGATCATAAGG - Intronic
911986784 1:104636953-104636975 AACAAAACCAGTAGGTAATATGG + Intergenic
915610674 1:156989468-156989490 ATCTGATTGTGTAGATAATAAGG - Intronic
918775162 1:188619511-188619533 ATCAAAATCAGTAGCTAATAGGG + Intergenic
919363906 1:196632400-196632422 ATCTAAATCTGTAAGAGAAATGG + Intergenic
921688106 1:218114088-218114110 AGGTAATTATGTAGGTAATAAGG + Intergenic
922315358 1:224436778-224436800 ATTTTATTCTGTAGGTAATGTGG - Intronic
1065475396 10:26131605-26131627 TTCTAAATATCTAGATAATAAGG - Intronic
1066087272 10:31983274-31983296 ACCTAAACCTATAGGTAATAAGG - Intergenic
1067074450 10:43166990-43167012 ATTTTAATTTGTAGGTAAGAAGG + Exonic
1068959615 10:62853278-62853300 ATCTAAAACTATGGGTAATGAGG - Intronic
1070662123 10:78314504-78314526 ATTTGAATCTGTAAGAAATATGG - Intergenic
1071816530 10:89237880-89237902 CTCTAAATCAGGAGGTCATAAGG + Intronic
1071911934 10:90246426-90246448 CTCTGAATCTGGAGGTAAGAAGG + Intergenic
1072875026 10:99163331-99163353 AAATAAATCTGAAGGAAATATGG - Intronic
1077799008 11:5519816-5519838 CTCAAAATCTATAGGTAATCAGG - Intronic
1078272337 11:9807681-9807703 AACAAAATCTCTAGGTAATACGG - Intronic
1079355004 11:19723485-19723507 ATCTAAAGCAGTAGCTCATATGG - Intronic
1079539628 11:21557220-21557242 ATGGAACTCTGTAGGCAATATGG + Intronic
1079794345 11:24780668-24780690 ATGTAAAACTCTTGGTAATATGG - Intronic
1079821582 11:25137906-25137928 ATCTGAACCTATAGGAAATATGG + Intergenic
1087443144 11:98210228-98210250 ATGTAGATCTGTGGGAAATAAGG + Intergenic
1089464128 11:118673107-118673129 ATCTAAAACAGCAGGGAATAAGG - Intronic
1090462122 11:126900886-126900908 ATGTAAAACTGTAGGAAAAAAGG + Intronic
1093779821 12:23122160-23122182 ATGTAAATCTGGAGGTACCAAGG - Intergenic
1094213171 12:27913849-27913871 AAACAAATCTGTAGTTAATAAGG + Intergenic
1095758104 12:45794095-45794117 ACCTGAAACTGCAGGTAATATGG + Intronic
1095760704 12:45832180-45832202 ATATAAAACTGTAGGTTTTAGGG + Intronic
1095874907 12:47069439-47069461 ATCTAAATCTTTAGATAATGTGG + Intergenic
1097931294 12:65189888-65189910 ATCCAAATCTATAGGTATTACGG - Intronic
1098257613 12:68633301-68633323 ATATAAATCATTAGGGAATAGGG - Intronic
1098288741 12:68934394-68934416 ATCTATATCTGTAAGAAAGAAGG - Intronic
1098615827 12:72520769-72520791 ATCTAAGTCTTAAAGTAATAAGG + Intronic
1098624083 12:72640632-72640654 ATCTAAGTCTTAAAGTAATAAGG + Intronic
1099777623 12:87153076-87153098 ATGTAAATCTCTGGGAAATAAGG + Intergenic
1101454968 12:104821776-104821798 TTCTAAACCTGTAGGTACTAGGG + Intronic
1102271004 12:111535272-111535294 ATCTAAAACTCTAGTTAGTAAGG + Intronic
1103029760 12:117603532-117603554 CTCTAAATCCGTTGGTCATAGGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106889171 13:34224737-34224759 AAATAAATCTGTAGGTAATCAGG + Intergenic
1110603089 13:77399122-77399144 TTTGAAATCTGTAGGGAATATGG - Intergenic
1110982745 13:81922046-81922068 GGCTAAATCTGTAGTTAGTATGG - Intergenic
1115421027 14:33195884-33195906 CTCTAAAACTGTAGGTAAATGGG + Intronic
1116486085 14:45451027-45451049 GTCTAAATCTGGAAGTAAAAGGG - Intergenic
1118247444 14:64125038-64125060 GTCTAAAACTGTCAGTAATAGGG + Intronic
1118460954 14:65986522-65986544 AGATAGAGCTGTAGGTAATATGG + Intronic
1120386177 14:83848917-83848939 ATCTAAATGAGTAGGTAAGCCGG + Intergenic
1125016511 15:34942250-34942272 TACAAAATCTGTAGATAATAAGG - Intronic
1125074182 15:35593778-35593800 ACTTAAATCTGTAGGAAATGGGG - Intergenic
1126401482 15:48275827-48275849 ATCACATTCTGTAGGTAATGAGG + Intronic
1127076398 15:55330638-55330660 ATTTTATTCTGTAGGTAATAGGG + Intronic
1128770838 15:70281223-70281245 TTCTATATTTGTAGGCAATAAGG - Intergenic
1131982537 15:98008726-98008748 TTCAAAATCTAAAGGTAATAAGG - Intergenic
1133553465 16:6882083-6882105 ATCTTAACCTGCAGGGAATAGGG - Intronic
1135483111 16:22839656-22839678 ATCAGAATCTTTAGGTAAAAGGG - Intronic
1135815649 16:25630287-25630309 TTTTAAATCTGGAGGTAAGATGG - Intergenic
1137626234 16:49910497-49910519 TTCTAAATCTTTAGGTTTTAAGG + Intergenic
1138971358 16:62148051-62148073 ATTTAAACTTGTAAGTAATATGG + Intergenic
1139919862 16:70452701-70452723 TTCCAAATCTGTTGTTAATAAGG - Intergenic
1144230312 17:13196170-13196192 ATCTTAATCTTGAGATAATATGG - Intergenic
1146663147 17:34678567-34678589 GCCTAATTCTGTAGGCAATAGGG - Intergenic
1150859314 17:68785052-68785074 ATTTCAAGCTGTATGTAATAAGG - Intergenic
1154283361 18:13028470-13028492 ATCTAAATCTTTAAGTCATCTGG + Intronic
1154976462 18:21461982-21462004 ATCTAAACCTTTAGGGAACACGG + Intronic
1155309644 18:24510950-24510972 ACCTGAGTCTTTAGGTAATAAGG - Intergenic
1155914997 18:31548485-31548507 ATCTAAGTCTGTAGCTTAAATGG + Exonic
1157737579 18:50063823-50063845 ATCTATATTTGAAGCTAATAAGG + Intronic
1163569641 19:18073361-18073383 GTTTAACTCTGAAGGTAATAGGG - Intronic
1165121983 19:33566013-33566035 ATCTAAATCTGCAGGTTGAAAGG + Intergenic
1165298201 19:34945955-34945977 ATCTAACACTGAAGGAAATAAGG + Intergenic
925234825 2:2268865-2268887 AGATAAATCTGTAGGGAAGAGGG + Intronic
925481160 2:4276108-4276130 ATCTAGATCTGTGGAAAATAAGG + Intergenic
925517473 2:4699492-4699514 AACTCACTCTTTAGGTAATATGG + Intergenic
930219682 2:48733741-48733763 ATATAAGTCTGTAGGGAAAATGG - Intronic
930769263 2:55115448-55115470 ATCTATATATATAGGTAACAGGG + Intergenic
933885670 2:86718112-86718134 ATCTGAAGCTGTAGGTAATGAGG + Intronic
933924508 2:87078593-87078615 ATCTGAAGCTGTAGGTAATGAGG - Intergenic
936003156 2:108854953-108854975 ATCTTAATCAGTATGAAATATGG - Intronic
937535334 2:122879629-122879651 TTCTAAATCTTCAGGAAATATGG - Intergenic
937996295 2:127697305-127697327 AATTTAATCTGTAGGAAATAAGG + Intergenic
938661690 2:133493477-133493499 AACTCAATCTGTAGGTACCACGG + Intronic
939521514 2:143237061-143237083 ATTTCATTCTGTAGGTAATGTGG + Intronic
939568162 2:143809302-143809324 ATCTAATTCTGTAAGTTATTTGG + Intergenic
942237750 2:173928721-173928743 CTCTAATTATATAGGTAATACGG - Intronic
943897989 2:193392211-193392233 AACTAAATCTGCAGGTATTAAGG - Intergenic
943969406 2:194384621-194384643 ATCTTAAGCTGTAGTGAATATGG - Intergenic
944380159 2:199099723-199099745 ATGGTAATCTTTAGGTAATAAGG + Intergenic
944698125 2:202221449-202221471 ATCTAAATAAGTGGGTAATTTGG - Intronic
945412939 2:209533743-209533765 ATCTAAATCTGTTTGTGTTAGGG + Intronic
946876297 2:224133000-224133022 ATCTTATCCTGTAGGTGATAGGG + Intergenic
948130388 2:235596445-235596467 ATCCAAATCTGCAGGTAACAAGG - Intronic
1170298270 20:14853067-14853089 ATCTTACTCTGTAGATAATGGGG + Intronic
1173421270 20:42903288-42903310 ATCCACAACTGTAGGGAATATGG - Intronic
1175577512 20:60072836-60072858 ATCATAATTTGTAGATAATAAGG - Exonic
1176744320 21:10638162-10638184 ATATAAAACTGAAGGTAAAATGG - Intergenic
1177164949 21:17590044-17590066 ATATAAATCCATAGGGAATATGG - Intronic
1177383925 21:20383514-20383536 ATAGAAATCTGTAGCAAATATGG - Intergenic
1177558476 21:22720306-22720328 AACTAAATCTGAGGGTATTAGGG - Intergenic
1184088000 22:42277166-42277188 ATTTCAATCTGTAGGGAAGAGGG - Intronic
1184396378 22:44244205-44244227 ATCTAAAACTATAGATGATATGG - Exonic
949590120 3:5485491-5485513 AACAAAAACTGTAGGTAAGATGG - Intergenic
949597260 3:5561291-5561313 AGCTAAATGTGTAGGTAATAAGG + Intergenic
951031214 3:17884011-17884033 CTCTGAATCTGCAGGGAATATGG + Intronic
951577497 3:24128711-24128733 TTCCACATCTGTAAGTAATATGG - Intronic
955262090 3:57402058-57402080 TTCTAAATTTGTAGTTAATTTGG + Intronic
955420939 3:58737050-58737072 ACTTATAACTGTAGGTAATATGG - Intronic
955529318 3:59856747-59856769 ATCTAATTCTGTGGGAATTAAGG + Intronic
956673896 3:71716684-71716706 AACTAAATCTGAAGGTGGTAAGG + Intronic
957669088 3:83277424-83277446 ATCTAAATTTGTAGTTACAAGGG + Intergenic
957838836 3:85639075-85639097 GTTTAAATTTGTAGGTAATATGG + Intronic
959140843 3:102484931-102484953 ATTTTAATCTATATGTAATAGGG + Intergenic
962504130 3:136028775-136028797 ATCTGCATTTGGAGGTAATATGG + Intronic
962570893 3:136712730-136712752 ATCGAAATCTCTTGGTCATAAGG - Intronic
965611333 3:170546973-170546995 ATATAAATCTCTTGGAAATATGG - Intronic
966154513 3:176901566-176901588 ATTTACATATGTAGGTAAGAAGG + Intergenic
967585015 3:191202647-191202669 ATTTAAATCTGAAGTTAATGTGG - Intronic
969830330 4:9790732-9790754 ATCTGAATTTCTAGGGAATAGGG + Intronic
970013567 4:11487539-11487561 ATCTAACTCTGAAGTTCATATGG - Intergenic
970336374 4:15048987-15049009 ATTTAAATCTGTAGCTTTTATGG + Intronic
970410237 4:15799003-15799025 ATTTAAATCTTTAGTAAATAAGG - Intronic
970476428 4:16428532-16428554 ATCTAAAAATGCAGTTAATATGG + Intergenic
971940157 4:33203716-33203738 ATATGATTCTGTAGATAATATGG - Intergenic
972057077 4:34816346-34816368 AACAAAATCTTTAGGAAATATGG + Intergenic
972347368 4:38203891-38203913 TTCAAAAGCTGTAGGTGATAGGG + Intergenic
972430097 4:38972811-38972833 AACTAAATCTCTAGTAAATAAGG - Intronic
972921895 4:43953044-43953066 ATGTAAATGTATAGATAATATGG - Intergenic
972942143 4:44208921-44208943 ATCTAAATCTGTAGGTAATAAGG + Intronic
972989021 4:44800604-44800626 TTCTAAATCTTTAAGGAATATGG - Intergenic
973100636 4:46264609-46264631 ATCTATATCTATAAGGAATATGG + Intronic
973748802 4:53991298-53991320 ATATAAATCTGTACATAAGATGG + Intronic
975013448 4:69382326-69382348 ATGTAAATGTTTAGCTAATAGGG + Intronic
975437276 4:74367170-74367192 ATTTAAATCTGTATGTGTTAAGG - Intronic
976059944 4:81115796-81115818 ACCTAAATTAATAGGTAATATGG - Intronic
976691573 4:87873108-87873130 ATCTATAGCTTTAGGTAAGATGG - Intergenic
976776220 4:88709020-88709042 GTCTAAATCTGGAGGTATTGAGG + Intergenic
977160998 4:93635069-93635091 ATAGAAATCTGTAGGTTGTATGG - Intronic
978499911 4:109398397-109398419 TTCTAAATCTGTATGTATTTTGG - Intergenic
978804885 4:112789416-112789438 ATCTAAATCAGCAGGTCACATGG + Intergenic
979720826 4:123898431-123898453 ATATAAATATGTAGCAAATATGG - Intergenic
979845185 4:125500023-125500045 ATCTAAATGTGTATTTAATTTGG - Intergenic
980944247 4:139303105-139303127 CACTAAATCTGTAGGGCATATGG - Intronic
982664999 4:158250974-158250996 CTTCAAATCTGTAGGGAATAGGG - Intronic
983009508 4:162529197-162529219 ATGTAAATCAATACGTAATACGG + Intergenic
984371134 4:178865948-178865970 ATGTATATCTGTAGTTAAAATGG + Intergenic
986436326 5:7735259-7735281 ATCTTAATTTGTAGGTGATATGG - Intronic
986620369 5:9666668-9666690 AACTAGATCTGCAGATAATAGGG + Intronic
990101453 5:52194605-52194627 ATGAAAATATGTTGGTAATAGGG + Intergenic
992027362 5:72683586-72683608 AACTAAAACTGTAGATAATGGGG - Intergenic
992045602 5:72885592-72885614 ATCTAAATCTGTATGTACTGAGG - Intronic
994225586 5:97248834-97248856 ATATAAATCTTTATGTCATAAGG + Intergenic
994282266 5:97919805-97919827 AGCTAAATCTGTGTTTAATAAGG + Intergenic
998670816 5:144351256-144351278 ACTTGATTCTGTAGGTAATAAGG + Intronic
999655772 5:153809150-153809172 ATTTATATCTGTGGGAAATATGG - Intronic
1003195084 6:3907190-3907212 ATCCAAATCTGCAGGGTATAAGG - Intergenic
1003450610 6:6228222-6228244 TTCTAATTTTGTAGGTATTATGG - Intronic
1004454231 6:15776807-15776829 ATGTAAGTGTGAAGGTAATATGG + Intergenic
1004683154 6:17916313-17916335 AAATAAATGGGTAGGTAATAAGG + Intronic
1004770740 6:18778220-18778242 ATCTGAATCTGAAGGTAACTAGG - Intergenic
1010369973 6:75096302-75096324 ATATAGATCTTTAGGTAATGGGG - Intronic
1010924912 6:81733069-81733091 ATCTAACTCTTAAGGTAATGAGG + Intronic
1013624445 6:111922750-111922772 ATCTAAATCTGTTTTTATTAAGG - Intergenic
1015094667 6:129400500-129400522 AGTTAAATCTGTAGGTAGAATGG + Intronic
1015915051 6:138207678-138207700 ATCTAATTCTGATGGTAAAAAGG + Intronic
1015994547 6:138984787-138984809 AACTAATTGTGTAGGTAACAGGG - Intronic
1017322065 6:153105850-153105872 ATTTCATTCTGTAGGTAATGGGG + Intronic
1020641309 7:10757522-10757544 AAATAAAACTGTAGGCAATAGGG - Intergenic
1020914270 7:14172417-14172439 ATCTAAAACAGTGGTTAATAGGG + Intronic
1021254787 7:18377451-18377473 TCCTAAATCAGTAGTTAATATGG - Intronic
1021669935 7:23025214-23025236 ATCTAAATCTTTAAGTCATTTGG - Intergenic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1030937899 7:115608705-115608727 ATAAAAATCTGGAGGAAATAAGG + Intergenic
1031561010 7:123238251-123238273 ATCAAAATCTATAGTTAAAAAGG - Intergenic
1033168869 7:139065992-139066014 ATCAGAATGTGTAGGTAAAAGGG + Intronic
1035193771 7:157197073-157197095 ATCTAAATCAGTAAGTAAAAAGG + Intronic
1038047352 8:23776848-23776870 ATCTTAATCTTTAGGCAATAGGG + Intergenic
1038167282 8:25098155-25098177 ACATAAATTTGAAGGTAATAGGG + Intergenic
1038933256 8:32218921-32218943 TTCTGAATCTGTAGTTATTAAGG - Intronic
1041422492 8:57683708-57683730 ACTTAAATCTGGAGGTAATGTGG - Intergenic
1041492315 8:58448056-58448078 ATCTAAATCAGTAAGTAAAAAGG - Exonic
1041617287 8:59922038-59922060 ATTTGAGTCTGTATGTAATATGG + Intergenic
1046714525 8:117552938-117552960 ACATAAATATGTATGTAATATGG + Intergenic
1049020281 8:139952182-139952204 ATCTAATTCTGAAAGTAATGTGG - Intronic
1051978927 9:22989566-22989588 TTTTAAATCTGTAGGACATAGGG - Intergenic
1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG + Intronic
1055062519 9:72084763-72084785 GTGTATATCTGTAGGAAATAAGG + Intergenic
1056142176 9:83693039-83693061 ATGTACATTTGTAGGAAATATGG - Intronic
1057595475 9:96412488-96412510 ATCTAAATCTGAATGTGAAAAGG - Intronic
1059704686 9:116810870-116810892 ATCTAAATAGGCAGATAATAAGG - Intronic
1059912565 9:119062122-119062144 TTCAAAATATGTAGATAATATGG + Intergenic
1060060017 9:120451052-120451074 ATCCAAATCTGTGTGTCATATGG + Intronic
1060193603 9:121608630-121608652 ACATAAAGCTGTAGGCAATAGGG + Intronic
1203491385 Un_GL000224v1:108656-108678 ATCAAAGCCTGTAGTTAATACGG - Intergenic
1203504009 Un_KI270741v1:50526-50548 ATCAAAGCCTGTAGTTAATACGG - Intergenic
1185797572 X:2980195-2980217 ATCCTAATCTGTAGTTTATAGGG + Intergenic
1188333684 X:28901886-28901908 ATCTAACTCTTTAAGTAATTTGG + Intronic
1188812326 X:34665842-34665864 ATCAAAATCTGTAGTTTAAACGG + Intergenic
1188908421 X:35816185-35816207 ATCTAATTTTTTAGATAATAGGG - Intergenic
1189122575 X:38410455-38410477 TTCTAAATCTGGAGGAAAAATGG + Intronic
1194861855 X:99009166-99009188 AACTAAATCTGTGGGAAAAATGG + Intergenic
1196121367 X:112054425-112054447 ATGTAACTCAATAGGTAATAGGG + Intronic
1197539729 X:127743344-127743366 CTCCAAATCTGTAAGAAATATGG - Intergenic
1201776511 Y:17671671-17671693 ATAAAAACCTGAAGGTAATAAGG + Intergenic
1201825045 Y:18234321-18234343 ATAAAAACCTGAAGGTAATAAGG - Intergenic