ID: 972942281

View in Genome Browser
Species Human (GRCh38)
Location 4:44210952-44210974
Sequence GAAGTTCACCAGTCCTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972942281 Original CRISPR GAAGTTCACCAGTCCTCTAG AGG Intronic
902663719 1:17923018-17923040 CAAGTTCTCCAGATCTCTAGAGG + Intergenic
906588593 1:47002386-47002408 GATGCTCTCCTGTCCTCTAGTGG + Intergenic
916208390 1:162337346-162337368 GAAGTTGAACTGTCCTTTAGAGG + Intronic
919987205 1:202683870-202683892 GAACATCACCAGCACTCTAGAGG - Intronic
1064922429 10:20533242-20533264 AAATTTCACCAGTACTCTACAGG + Intergenic
1066245846 10:33582683-33582705 GAAAGTCACCTGTGCTCTAGAGG - Intergenic
1068479442 10:57570987-57571009 GTAATTCACCACTCCCCTAGAGG + Intergenic
1069141572 10:64834003-64834025 GAATGTCACCAGTGTTCTAGAGG + Intergenic
1086155277 11:83658775-83658797 GAAGTTTACCACTTCTCTAGTGG + Intronic
1088202318 11:107351801-107351823 GAAGTACACAAGGCCTCTTGAGG - Intronic
1094669836 12:32558916-32558938 AAAGATGACCAGTCCTCAAGAGG + Intronic
1097629390 12:62041361-62041383 GGAGTTCACCAGTCCACAGGAGG - Intronic
1100237583 12:92676375-92676397 GCAATTCACCAGTCTTCTATAGG + Intergenic
1101173177 12:102120530-102120552 GAAGTTAAGCAGGCCTCTACGGG - Intronic
1102629672 12:114266869-114266891 GAAGCTCTCAAGTCCTCTTGCGG - Intergenic
1103627184 12:122228355-122228377 GAAGATGACCAGTTCTCTGGGGG - Intronic
1104230362 12:126878482-126878504 GAAGTTCACCAGGCTTCAACTGG - Intergenic
1110306552 13:73994437-73994459 GAATTTCAACAGTCCTCAAATGG - Intronic
1112520603 13:100091489-100091511 GAAGTTCACTATCACTCTAGGGG + Intronic
1112720438 13:102237460-102237482 GACATTCACCACTCCTCAAGGGG - Intronic
1120388780 14:83879646-83879668 GAAGGCCATCACTCCTCTAGAGG + Intergenic
1126205402 15:46039454-46039476 GATTTTCTCCAGTCTTCTAGGGG + Intergenic
1126950448 15:53874566-53874588 GATGTTCACCTGTCCTCTCTGGG - Intergenic
1127605582 15:60584058-60584080 AGAGTCCTCCAGTCCTCTAGTGG - Intronic
1128266163 15:66268359-66268381 GCAAAACACCAGTCCTCTAGAGG + Intergenic
1139227082 16:65242946-65242968 GGAGTTCACCACTCCTCCAGGGG - Intergenic
1144640092 17:16932178-16932200 GAAATTCACCAGTCGTCTCTGGG - Intronic
1149438688 17:56656388-56656410 TAAGTTCCACAGTCCTCTGGGGG - Intergenic
1149819262 17:59758994-59759016 GAAGATCACCAGAACTCTAGAGG + Intronic
1152200777 17:78944662-78944684 GAAGTTCACCTGCCCTTTAGAGG - Intergenic
1153780934 18:8494557-8494579 TAAGATCACCCTTCCTCTAGTGG - Intergenic
1155326004 18:24665562-24665584 GAAGTTCTTAAGTCCTCAAGTGG - Intergenic
1155879128 18:31122324-31122346 GAAGGTCACCAGTTGGCTAGAGG - Intergenic
1156811955 18:41263453-41263475 GAAGTGCCCCAGTCCTCTGGAGG + Intergenic
1161664346 19:5565795-5565817 CACATTCACCAGCCCTCTAGAGG - Intergenic
1164294397 19:23896815-23896837 GAAGTTCACCAGCCCACCTGTGG - Intergenic
1165900754 19:39168245-39168267 GCAGGTGACCACTCCTCTAGGGG - Exonic
930984692 2:57570817-57570839 GGAGTTCAGCAGGCCTCTTGGGG + Intergenic
931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG + Intergenic
933165682 2:79072322-79072344 GAAGTTCACAGGCCCTATAGAGG + Intergenic
939250733 2:139678797-139678819 GAAGTTCCACAGTTCTTTAGTGG - Intergenic
941108454 2:161390363-161390385 GAGGTTCAACAGTACTCTGGTGG - Intronic
949058053 2:241939961-241939983 GAAGTTCACCCGGGCTCCAGAGG - Intergenic
1170484649 20:16804117-16804139 GTATTTCATTAGTCCTCTAGAGG + Intergenic
1178216679 21:30606349-30606371 GAAGTTCCCCAGGCCTCAGGTGG - Intergenic
1178472578 21:32906560-32906582 TAAGTTGACCTGTCCTGTAGAGG - Intergenic
1180251812 21:46595141-46595163 GATGGTCACAATTCCTCTAGAGG + Intergenic
1183700184 22:39446602-39446624 AAGGTTCACGAGGCCTCTAGGGG - Intergenic
953201101 3:40779511-40779533 GAAGTCCACAAGTCCTCTATAGG + Intergenic
954109688 3:48427080-48427102 AAAGTTCTCCAGCCCTCAAGGGG + Intronic
954226793 3:49187084-49187106 GAAATTCACTATTCCTATAGTGG + Intronic
954260191 3:49433138-49433160 TAAGTTCACCAGGCCTGGAGTGG - Intergenic
955457943 3:59145217-59145239 ATAGTTCAACAGTCCTCCAGAGG - Intergenic
962960681 3:140308616-140308638 AAAATTCACCAGTTCTCTTGGGG - Intronic
968461875 4:730287-730309 GAAATTCACCCCTCCTCTGGGGG + Intronic
971022435 4:22550653-22550675 GAAATTCATCAGTTCTATAGTGG + Intergenic
972297245 4:37751778-37751800 GTATTTAACCAGTCCTCTACTGG + Intergenic
972942281 4:44210952-44210974 GAAGTTCACCAGTCCTCTAGAGG + Intronic
975324769 4:73046868-73046890 TAAGTTCACTAGTCTTATAGGGG + Intergenic
982163172 4:152590454-152590476 GGAGTTCTGCAGTCCTCTGGAGG - Intergenic
982350611 4:154410909-154410931 GAAATTCACTAGTAGTCTAGTGG - Intronic
991398629 5:66230723-66230745 GAAGTACACAAGGCCTCTTGAGG - Intergenic
992126289 5:73645744-73645766 GAAATGCACAAGACCTCTAGGGG - Intronic
994358699 5:98825398-98825420 GAAGCCCACCAGTCCTGAAGGGG + Intergenic
995972975 5:117995478-117995500 GAATTTCACCATTCCTCTGCTGG + Intergenic
996991082 5:129632887-129632909 TAAGTTCAACAATCCTCTAATGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1001873178 5:175175585-175175607 GAAGTTCACCAATCCTCCCAAGG + Intergenic
1002694136 5:181072831-181072853 GATGTTCTCCAGTCCTCCCGTGG + Intergenic
1004807367 6:19218810-19218832 TAATTTCACCAGTCATCTAAAGG - Intergenic
1006403044 6:33828922-33828944 GGAGCTCACCAAGCCTCTAGGGG + Intergenic
1008099417 6:47375360-47375382 TAAGTTCATCAGTCCTAAAGGGG - Intergenic
1010018366 6:71130678-71130700 GTATTTCACAAGTCCTTTAGAGG - Intergenic
1013789903 6:113825054-113825076 GATGTTGCCCAGTACTCTAGTGG + Intergenic
1014575915 6:123072312-123072334 GAAGTTAACCAGTCTTTTAGTGG + Exonic
1015470984 6:133606174-133606196 TAAGTTAACCAGTCCTCTATTGG - Intergenic
1016033149 6:139358126-139358148 GAAGTTCTTCAGTCCTGAAGGGG + Intergenic
1020401800 7:7787084-7787106 TAAGTTCAGCAGTTTTCTAGGGG - Intronic
1021309899 7:19081003-19081025 GAAGTTCACAAAACCTCTTGAGG + Intronic
1026399238 7:69992634-69992656 GGAGTTTACCAGTCCTCCAGTGG + Intronic
1031661412 7:124429644-124429666 GAAGGTCAGCTGTTCTCTAGTGG + Intergenic
1035134001 7:156682483-156682505 GAAATTCACCAGTACTATACTGG + Exonic
1037730787 8:21522302-21522324 GAAGTTCAACAATTATCTAGTGG + Intergenic
1040908597 8:52494658-52494680 GCAGGTCACAAGTCCTCCAGTGG - Intergenic
1042759092 8:72251715-72251737 GAAGTTCTCCAGGGCTCTCGCGG - Intergenic
1048580210 8:135724303-135724325 GCAGATCACCAGACCTCAAGAGG - Intergenic
1048599752 8:135907153-135907175 GAAGTTCACCTGTGCTTTGGAGG + Intergenic
1186271925 X:7898136-7898158 GAAGTTCAATAGTGCTCTAAAGG - Intergenic
1192467975 X:71371228-71371250 TAAGTTCTCTTGTCCTCTAGGGG + Intronic
1193695891 X:84707439-84707461 CAAGTCTACCAGCCCTCTAGAGG - Intergenic