ID: 972943323

View in Genome Browser
Species Human (GRCh38)
Location 4:44223505-44223527
Sequence AAGTTTTTACTGATTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972943323 Original CRISPR AAGTTTTTACTGATTGAATA TGG (reversed) Intronic
905159271 1:36017145-36017167 AAGTTTTAAGTGTTTGCATATGG - Intronic
905602475 1:39265688-39265710 CAGTTTCTACTGAATGCATATGG + Intronic
906978309 1:50599558-50599580 TAATTTTTACTGATTTAACAGGG - Intronic
906997174 1:50808975-50808997 AAGTATTTGCTGTTTGAATCTGG - Intronic
908024135 1:59930597-59930619 AATTTTTTACTGTTTAATTATGG + Intergenic
909064659 1:70920507-70920529 AAGTTATTAATGATTAATTAAGG + Intronic
909526999 1:76636054-76636076 AAGTTTCTAGTGCTTGAACAAGG - Intergenic
910282307 1:85514717-85514739 AAGTTTGGACAGTTTGAATATGG - Intronic
910586018 1:88880124-88880146 AAATGTTTACTGAATTAATATGG + Intronic
912065489 1:105735645-105735667 AGTTTTTAACTGATTGTATATGG - Intergenic
912884508 1:113455888-113455910 CAGTATTTTCTGATTAAATAAGG + Intronic
913501059 1:119473152-119473174 AAGTTTTTGCTGTATGGATATGG - Intergenic
914207783 1:145549175-145549197 AAGTTTGGACAGTTTGAATATGG + Intergenic
914432122 1:147628410-147628432 GAGTTCTTAATTATTGAATAGGG + Intergenic
916689924 1:167180356-167180378 ACTTGTTTACTGATTGAATTGGG + Intergenic
917830495 1:178879264-178879286 AAGGATTCAATGATTGAATATGG - Intronic
918624853 1:186645485-186645507 AAGATTTTCCTTATTTAATAAGG - Intergenic
918936318 1:190926792-190926814 AAGTCTTAACTGATTCAACAAGG + Intergenic
919235499 1:194836970-194836992 AAGGTTATAATGTTTGAATATGG + Intergenic
919555257 1:199045125-199045147 TAGTTCTTACAGACTGAATAGGG + Intergenic
919586778 1:199448847-199448869 AACTATTTACTGAATCAATATGG + Intergenic
919863595 1:201761093-201761115 AAGATTTTGTTGACTGAATAAGG + Intronic
920672057 1:208011480-208011502 AAGTATTTGCTAATTTAATAGGG + Intergenic
922003280 1:221502887-221502909 AACTTTTTATTGTTTTAATATGG - Intergenic
922883023 1:228996868-228996890 AAGTTTTTTGTAATTGGATATGG + Intergenic
923373811 1:233339946-233339968 AAGTGTTTGCTGAATGAATGAGG - Intronic
923818652 1:237409256-237409278 AAGTTTCTTATGATTGAGTATGG + Intronic
924283226 1:242459391-242459413 AAGATTTTACCCATTGAATGGGG - Intronic
1064983155 10:21184114-21184136 AAGCTTTTAATGAGTGAAAAAGG + Intergenic
1065117112 10:22493736-22493758 TAGTTTCTACTGAATGCATATGG - Intergenic
1066052748 10:31650237-31650259 AAGTTTTTATTGAATTAAGAGGG - Intergenic
1066066444 10:31764687-31764709 AAGTTTTTACTCATGGCAGAAGG - Intergenic
1066545338 10:36493874-36493896 ATGTCTTTACTGATTGATTAAGG + Intergenic
1066668027 10:37805539-37805561 AGGTTTTTACAGAGTGAATGTGG - Intronic
1067687228 10:48473499-48473521 AAGTGTTTAATGAATGAATGAGG + Intronic
1067981810 10:51095539-51095561 AAGGTTTTCCTAAGTGAATAAGG - Intronic
1071141006 10:82509546-82509568 AAGTGCTTACTGATTGTTTAGGG - Intronic
1071594813 10:86912756-86912778 AAGTTTAAACTGATTGATTGAGG + Intronic
1073703098 10:105952388-105952410 CAGTATTTACTGACTGAAAAAGG - Intergenic
1074722628 10:116275455-116275477 CAGTTTCTACTGAATGTATATGG - Intergenic
1074936228 10:118184229-118184251 AAATATTTATTGATTGAATTTGG - Intergenic
1074990839 10:118705192-118705214 AAGTTTTTATTAATTTAAAAAGG - Intronic
1076091331 10:127688758-127688780 AAGTTTTGACTGCGTGAGTAGGG - Intergenic
1077993193 11:7430783-7430805 AAGTTTTTACTCATGGCAGAAGG - Intronic
1079287739 11:19154250-19154272 AAGTATTTGTTGAATGAATAGGG + Intronic
1079609534 11:22414783-22414805 TATTTTTAACTGAATGAATAAGG - Intergenic
1080761315 11:35251967-35251989 ATGTTTTGAATGATTGAAGATGG - Exonic
1081071040 11:38608653-38608675 AAGTTTTTACTCATGGCAGAAGG + Intergenic
1081450127 11:43162770-43162792 AAGATTTTACCCATTGAATGGGG + Intergenic
1083063531 11:59899266-59899288 AAGTTTTCACTGAATGAGCATGG + Intergenic
1085821574 11:79799147-79799169 AAGTTTTTGAGAATTGAATAAGG - Intergenic
1086545057 11:87958038-87958060 CAGTTTTTACAGAATGCATATGG - Intergenic
1086601888 11:88643175-88643197 AAGCTTTTACTCATTGCAGAAGG + Intronic
1086957118 11:92944623-92944645 AAGATTTTACCTATTGAATGGGG + Intergenic
1087510504 11:99086438-99086460 AAGCTTTTACTCATTGCAGAAGG + Intronic
1088425843 11:109701353-109701375 GGGTTTTTATTTATTGAATAAGG - Intergenic
1089045131 11:115495168-115495190 AAGTTTTCATTGTTTAAATAAGG + Intronic
1090677803 11:129019079-129019101 AAGTTTTGTTTGATGGAATAAGG + Intronic
1091019246 11:132083901-132083923 AAGTCTTTAATAATTGAGTAAGG - Intronic
1092028610 12:5264348-5264370 TTGTTTTGACTGATAGAATATGG - Intergenic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1094408101 12:30140197-30140219 AAGCTTTTACTCATGGAATAAGG - Intergenic
1095645198 12:44536220-44536242 AAGTATTTACTGAGTGAATAAGG - Intronic
1095918392 12:47503911-47503933 AAGTGTTTACTCATTGAAAAAGG - Intergenic
1096028905 12:48394117-48394139 AACTAGTTACTGATTGAAGATGG - Intergenic
1096323607 12:50637900-50637922 ATGTTTCTATTGTTTGAATATGG - Intronic
1097533909 12:60840818-60840840 AAGTTTTTACTCATGGCAGAAGG + Intergenic
1098098715 12:66989329-66989351 AAGTTTTTACTGAATGAATGTGG + Intergenic
1098901244 12:76114062-76114084 AAGTCATTACTGAGTGACTAGGG + Intergenic
1099185270 12:79509768-79509790 AAGTTTCACCTGATTGAAAAAGG + Intergenic
1099293004 12:80795297-80795319 AAGATTTTACTGAAGGAAAATGG + Exonic
1099577268 12:84396437-84396459 AAATTTTTACATATTGATTAAGG - Intergenic
1099742340 12:86655551-86655573 AAATTTTTTTTCATTGAATATGG - Intronic
1100623311 12:96302958-96302980 AAGCTTTTACTTTTTGAATTAGG - Intronic
1102327530 12:112000802-112000824 CAGTTGTTACAGATTGAATACGG + Intronic
1104056368 12:125233938-125233960 AATTTTTTGCTGATTTTATAGGG + Intronic
1104158145 12:126153086-126153108 AAGTCTTTTCTGATTCAATTTGG - Intergenic
1105530419 13:21214254-21214276 AATTTTTTAATGATGGAATATGG + Intergenic
1105542177 13:21325395-21325417 AGCCTTTTACTGATTGAATGAGG - Intergenic
1105777093 13:23673044-23673066 AAGCTTTAAATGTTTGAATAAGG + Intronic
1105994994 13:25662404-25662426 AACTTTTGACTGATTCTATATGG + Intronic
1107169805 13:37327395-37327417 AAGTTATAACTGATTGACTGTGG + Intergenic
1107654858 13:42581453-42581475 AAGTTGGTAGTGATTGATTATGG + Intronic
1107783533 13:43930781-43930803 GAGTTTCTACTGAATGTATATGG + Intergenic
1109072921 13:57791843-57791865 AAGTTTTAACTCAGTTAATATGG + Intergenic
1109465118 13:62721622-62721644 AAGATTTTACTGATACAATTAGG + Intergenic
1109768407 13:66935354-66935376 AATTTTTTAAAGACTGAATAAGG - Intronic
1110028511 13:70573070-70573092 AATTGTTTATTGCTTGAATATGG + Intergenic
1110039287 13:70731927-70731949 AATTTTGTCCTGATTGTATACGG + Intergenic
1110110727 13:71742310-71742332 AAGTTTTTACTGATATGCTATGG + Intronic
1110858064 13:80318754-80318776 AAGCTTCAACTGATTGAATGAGG - Intergenic
1111772635 13:92618044-92618066 AAGTTTTTATTAATTTCATATGG - Intronic
1111869592 13:93813566-93813588 TATTTTTTACTAATTAAATAAGG - Intronic
1112314845 13:98351699-98351721 AAGTTTTTACTCATGGCAGAAGG + Intronic
1112860140 13:103820081-103820103 AAGTTCTTACTTATGGAAGAAGG + Intergenic
1112893552 13:104269276-104269298 AAGCTTTTACTCATGGAAGAAGG - Intergenic
1114440935 14:22747221-22747243 AGGGTTTTACTGAATGAAAAGGG + Intergenic
1115370705 14:32610937-32610959 GTGTTTTTAATGATTGAATTTGG + Intronic
1115816962 14:37173891-37173913 GACTTTTTACTAATTAAATAGGG + Intergenic
1116612274 14:47091106-47091128 AATTATTTAATGATTGAGTATGG + Intronic
1117209413 14:53480502-53480524 AAGCTTTTACTCATTGCAGAAGG + Intergenic
1117760680 14:59024902-59024924 AAGTATTGATTGATTTAATATGG + Intergenic
1118472892 14:66091789-66091811 AAGTTTTCACTGGTTAAATTTGG - Intergenic
1118575207 14:67235310-67235332 AAGTTTGTTCTGCTTGAAAAGGG - Intergenic
1119128280 14:72148640-72148662 AACTTGGTATTGATTGAATATGG + Intronic
1119966473 14:78921798-78921820 AAGTTTATACTAGTTGTATATGG + Intronic
1120656979 14:87202382-87202404 AGGTTTTTAATAAATGAATAAGG - Intergenic
1122432351 14:101661907-101661929 AAGTTTTTACTCATGGCAGAAGG - Intergenic
1123838210 15:24218509-24218531 TAGTTTTTAACAATTGAATATGG - Intergenic
1123847760 15:24320800-24320822 TAGTTTTTAACAATTGAATATGG - Intergenic
1123866801 15:24528178-24528200 TAGTTTTTAACAATTGAATATGG - Intergenic
1124456205 15:29845134-29845156 CAGTTTTTAATGTTTTAATAAGG + Intronic
1125332403 15:38595034-38595056 AAGAGTTTACTGATGGAATTGGG + Intergenic
1125460381 15:39901095-39901117 TAGTTATTACTTATAGAATATGG + Intronic
1126023716 15:44426676-44426698 AAATATTTCTTGATTGAATAAGG + Intergenic
1126154961 15:45557300-45557322 AACTTTCAACTGATTGAATCAGG + Intergenic
1126387183 15:48106313-48106335 AAATATTTACTGAATGAACAAGG - Intergenic
1129567634 15:76640537-76640559 AAGATTTTACCCATTGAATGGGG - Intronic
1131723505 15:95197526-95197548 AAGCTTTTACTTAGTGAATTTGG + Intergenic
1131771464 15:95742493-95742515 AAGTTTGTAGTGATTTATTATGG - Intergenic
1131933112 15:97468116-97468138 AATTTCTAAGTGATTGAATATGG + Intergenic
1131979822 15:97984059-97984081 AAGATTTAACTGATTAAAAAGGG + Intergenic
1133070135 16:3241089-3241111 ATTTTTTTGCTGATTTAATAGGG - Intergenic
1137812517 16:51365977-51365999 AAATATTTACTGGATGAATAGGG + Intergenic
1138145694 16:54609038-54609060 AAGTCTTAGCTGATGGAATAAGG + Intergenic
1138501653 16:57448980-57449002 TAGTTATTACTGATTAAAAATGG - Intronic
1139735516 16:68984447-68984469 AACTTATTACTGATATAATAAGG + Intronic
1141039706 16:80662509-80662531 AAGTATGTACTGAATGAACATGG - Intronic
1141778448 16:86140418-86140440 AAGCTTTTACTCATGGAAGAAGG + Intergenic
1142297882 16:89238775-89238797 ATGTTTTTACTGATTCTACAGGG - Intergenic
1142648735 17:1332060-1332082 AAGTTTTTACTAAATGAATATGG - Intergenic
1144375964 17:14641817-14641839 AAGATTTTACTCATTGCAGAAGG - Intergenic
1144596046 17:16570947-16570969 AGCTTTTAACTGATTGAATCAGG - Intergenic
1145221228 17:21090869-21090891 CATTTTTTAGTGATTGAATCTGG - Intergenic
1148665881 17:49374448-49374470 AAGCTTTTACTCATTGTAGAAGG - Intronic
1149464256 17:56862462-56862484 ATGTTTTTATTCATTGATTAAGG - Intronic
1149939518 17:60848628-60848650 CAGTTTTTCTTTATTGAATATGG + Intronic
1155358730 18:24979492-24979514 ATGTTTTTAGTAATTGATTAGGG - Intergenic
1156795699 18:41043628-41043650 CAGTTTTTACTCATAGAATCAGG - Intergenic
1157097303 18:44697542-44697564 AAGGTTTTTCTGAATGAAAATGG - Intronic
1158016198 18:52787062-52787084 AAGCTTTTAATAATTGAGTAAGG - Intronic
1158933532 18:62344241-62344263 AAATTTTTATTTATTGAATAGGG - Intronic
1159183185 18:64936982-64937004 AAGTCTTTACTTCTGGAATATGG - Intergenic
1159459623 18:68707310-68707332 GACTTTTTACTCATTGGATATGG - Intronic
1159493663 18:69172127-69172149 ATTTTTTAACTGATTGAATGAGG - Intergenic
1159608106 18:70495948-70495970 ATGCTTGTACTCATTGAATATGG + Intergenic
1159910700 18:74143216-74143238 AAGCTGTTACTGATTCAGTAAGG - Intronic
1160312843 18:77811953-77811975 CAATTATTACTGAATGAATAAGG - Intergenic
1162125218 19:8495973-8495995 AAGTTTGTGCTGGGTGAATAGGG - Intronic
1163637229 19:18442903-18442925 AAGTTCTAGCTGATTAAATATGG - Exonic
1164515905 19:28935031-28935053 CAGATCTTACTGATTGAAAATGG + Intergenic
1164924833 19:32122106-32122128 AAGTTTTTACTGAATAAAATAGG + Intergenic
1166443256 19:42834676-42834698 AAGATTTTACCTATTGAATGGGG + Intronic
1166480219 19:43165401-43165423 AAGATTTTACCTATTGAATGGGG + Intronic
1166490045 19:43250946-43250968 AAGATTTTACCTATTGAATGGGG + Intronic
926339352 2:11892093-11892115 AAGTTCTTAATTTTTGAATATGG - Intergenic
927717729 2:25363411-25363433 AAATTTTTGCTAAGTGAATAAGG + Intergenic
928849466 2:35727179-35727201 GTGTGTTTTCTGATTGAATAAGG + Intergenic
929380599 2:41346943-41346965 AAGTTTAGACTGAGTGGATAAGG - Intergenic
930207602 2:48603588-48603610 AAGTTTTTACTCATGGCAGAAGG + Intronic
930960783 2:57259047-57259069 AAGATGTTACTGATGGAAAATGG + Intergenic
931115218 2:59159177-59159199 AAGTTTTGACTGAAAGAAAAGGG - Intergenic
932976491 2:76606427-76606449 AAGCTTTTACTCATGGCATAAGG - Intergenic
933183823 2:79256985-79257007 ACGTATTTACTCATGGAATAAGG + Intronic
935092258 2:99906622-99906644 ACCTTTTAACTGATTGAATCAGG - Intronic
935248881 2:101244046-101244068 AAGATTTTACCCATTGAATGGGG - Intronic
935287408 2:101577957-101577979 TACCTTTTACTGATTGTATATGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937022490 2:118670939-118670961 AGGTTTTTAATGATTGAAAAAGG + Intergenic
940009811 2:149040787-149040809 AAGACTTGACTGATGGAATACGG - Intronic
940075022 2:149731962-149731984 AAGTTTTTGCTTATTGAGAAGGG + Intergenic
940445870 2:153776916-153776938 AAGTTTTTCCTCAGTGAACAGGG + Intergenic
940482406 2:154251704-154251726 AAGTTTTTACTGATAAAAATGGG - Intronic
940542703 2:155042791-155042813 AGGTTTTTCCTGAATGACTAAGG + Intergenic
940627757 2:156196902-156196924 ACAAGTTTACTGATTGAATAAGG - Intergenic
941894635 2:170616715-170616737 AAGATTTTACCTATTGAATGGGG + Intronic
942414228 2:175741502-175741524 AAGTTTCCACTGGTTAAATATGG - Intergenic
943523118 2:188979310-188979332 AAGTTTTCACTGAATGAAACTGG - Intronic
943860226 2:192852610-192852632 AAATTTTTGCTTTTTGAATATGG - Intergenic
944751996 2:202718308-202718330 CAGTTTTTCTTCATTGAATATGG + Intronic
944871961 2:203921070-203921092 AAGTTTCTACTAAATGAGTATGG - Intergenic
945840316 2:214880037-214880059 AACATTTAACTGATTGAATCAGG - Intergenic
945893066 2:215450774-215450796 AAGCTTTTACTGATGGCAGAAGG - Intergenic
946070365 2:217029681-217029703 ATTTGGTTACTGATTGAATATGG + Intergenic
946118116 2:217481903-217481925 ATGTTGTTACTGATTGTATCAGG - Intronic
946528608 2:220547242-220547264 AAGTGTTTACTGAATTCATATGG - Intergenic
947932845 2:233977701-233977723 ATGTTTGAACTGAGTGAATAGGG + Intronic
948065575 2:235076302-235076324 AAGTTTCTACTAAATGAACAAGG - Intergenic
1168889362 20:1284341-1284363 AAATCTTTGCTGAATGAATAAGG - Intronic
1169007899 20:2224152-2224174 AAGTGTTTATGGATTGAACAGGG + Intergenic
1170340387 20:15320266-15320288 AAATTATTACTTATTGAGTAAGG + Intronic
1172441462 20:34969294-34969316 AAGTGTTTGCTAAATGAATAAGG - Intergenic
1173183910 20:40824833-40824855 AAGTTTGTTCTGATTGAAAAAGG - Intergenic
1173259001 20:41416484-41416506 AAGTATTTACTGAGTGGATAGGG - Intronic
1173274892 20:41571765-41571787 AAGCTTTTACTTTTTGAATCAGG + Intronic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1176013710 20:62916192-62916214 AAGTTGTTACTGATACAATATGG - Intronic
1177460211 21:21398974-21398996 AAATTTGTACTGACTTAATATGG - Intronic
1177486729 21:21767854-21767876 AAGTTTTGGCTGATAAAATATGG - Intergenic
1181450661 22:23017738-23017760 AAGTTCTTACTGACTGAGCATGG - Intergenic
1182002834 22:26935172-26935194 ATGGTTTTACTTATTGATTAGGG + Intergenic
1182007875 22:26976245-26976267 GCCTTTTAACTGATTGAATAGGG - Intergenic
1182931627 22:34179932-34179954 CAGTGCTTACTGACTGAATAAGG + Intergenic
1182967374 22:34534965-34534987 AAGTTTTTACTCATGGCAGAAGG + Intergenic
1185197674 22:49482453-49482475 AAGTTTTTATTAATTTAGTAGGG + Intronic
949144563 3:681898-681920 CAGTGTTCACTTATTGAATAGGG + Intergenic
949726985 3:7060370-7060392 TAGTTTTCACTGACTGAGTAGGG + Intronic
949738155 3:7198750-7198772 CAGTTTTTACAGACTGCATAAGG + Intronic
949797265 3:7864528-7864550 AAGCTTTTACTCATGGAAGAAGG - Intergenic
951805755 3:26641955-26641977 AAATGTTTACTAATTGAAAAAGG + Intronic
951830807 3:26924785-26924807 ATATTTTTATTGATTAAATATGG - Intergenic
952451318 3:33435876-33435898 GTGTTTCTACTGAATGAATATGG + Intronic
953379052 3:42452872-42452894 TAGTTCTGACTGATTAAATATGG + Intergenic
956398324 3:68849314-68849336 AAGTTTTCATTAATAGAATATGG + Intronic
956447490 3:69339919-69339941 AGTTTTTTTCTGATTGAATTAGG - Intronic
957002442 3:74901770-74901792 AAGATTTTGGTGATTTAATATGG - Intergenic
957999072 3:87728981-87729003 AAGTTTTAACTTTTTGATTAAGG - Intergenic
958813003 3:98883969-98883991 AAATGTTTATTAATTGAATAAGG + Intronic
959371875 3:105537156-105537178 ACCTCGTTACTGATTGAATAGGG - Intronic
959688424 3:109172479-109172501 CAATTTTTTCTGATTGATTAAGG + Intergenic
959744004 3:109755181-109755203 AACTTGTTACTGCTTGATTAAGG + Intergenic
959787585 3:110319490-110319512 AAGTTTTTCCTGTTTGCCTATGG + Intergenic
960490830 3:118314631-118314653 AACTTTCTACTCATTGCATAGGG - Intergenic
960543118 3:118882358-118882380 TATTTTTAACTTATTGAATATGG + Intergenic
961206313 3:125084933-125084955 AAGTTTCAATTGTTTGAATATGG + Intronic
962284125 3:134072692-134072714 AAGTTGTTACTAATTGCATGAGG + Intronic
962452588 3:135532980-135533002 AGGTTTTTACTGAGTGGATGTGG + Intergenic
963166214 3:142206765-142206787 AAGATTTTACCCATTGAATAGGG - Intronic
963301538 3:143602668-143602690 CTGTTTTTCCTGGTTGAATATGG + Intronic
965117319 3:164507537-164507559 ATGTTTTAATTGATTGATTAGGG - Intergenic
965128371 3:164660227-164660249 AAGTTTTCAATGCTTGAATTTGG + Intergenic
966033510 3:175379749-175379771 AAGGTTTGTCTGATTGAATATGG + Intronic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
966335829 3:178867073-178867095 AGCCTTTAACTGATTGAATAAGG - Intergenic
968113635 3:196071341-196071363 GAGTTTTGAATGATTCAATAGGG + Intronic
970377891 4:15477546-15477568 AAGTTTTTACTGACTTAGAATGG - Intronic
970439007 4:16063669-16063691 AAGTTTTTTTTGTTTGAATCAGG - Intronic
971363500 4:25957784-25957806 CAGTGTCTACTGAGTGAATATGG - Intergenic
971623763 4:28891526-28891548 TTGTTTTTACTTTTTGAATATGG + Intergenic
971962870 4:33511530-33511552 ATTGTTTTACTGGTTGAATAGGG + Intergenic
972300303 4:37779249-37779271 AAGCTTTTACTCATGGAAGAAGG - Intergenic
972943323 4:44223505-44223527 AAGTTTTTACTGATTGAATATGG - Intronic
973037895 4:45429810-45429832 AAGTTTTATCTGATTGAAATGGG + Intergenic
973591043 4:52442081-52442103 AAGATATAACTGATTGAATGAGG - Intergenic
973891334 4:55370220-55370242 AAGTTTTCACTGAATGAGCATGG + Exonic
974245966 4:59318124-59318146 AAGTTTTTACTGAAGGAAGCTGG - Intergenic
975567547 4:75775127-75775149 AATTATATACTGAGTGAATAGGG + Intronic
975953040 4:79798231-79798253 AAGTTTTCACTGATTGCAGAAGG - Intergenic
977201799 4:94124754-94124776 AAGATATTACTGATTGCTTAAGG + Intergenic
977792064 4:101117484-101117506 AAGATTTAATTTATTGAATAAGG + Intronic
978544506 4:109856439-109856461 AAGATTTTACTCATTGAATGGGG + Intronic
978843545 4:113245039-113245061 AAGTTTTTGCTATGTGAATAGGG + Intronic
980304834 4:131045927-131045949 ATGGTTTTAGTGATTAAATAAGG - Intergenic
981893760 4:149771941-149771963 AAGATTTAACTGATTGAAATGGG - Intergenic
982025015 4:151243940-151243962 AATTTTTTACTCTTTGAAGAAGG - Intronic
982399618 4:154952669-154952691 AAGTTTTTATTAATAGAAAAAGG - Intergenic
982849317 4:160292815-160292837 AAGGTTTTATTGATTGAAAAAGG + Intergenic
983467215 4:168109272-168109294 AAATTTTTGCTGAATAAATATGG - Intronic
984158666 4:176224726-176224748 AAGTGTTTTCTGTTTCAATAAGG + Intronic
986185735 5:5435504-5435526 AAGTATTTAGTGATGGAAAAAGG + Intronic
988286329 5:29221745-29221767 CTGATATTACTGATTGAATATGG + Intergenic
988700521 5:33669390-33669412 AACATTTCACAGATTGAATATGG - Intronic
989551999 5:42746214-42746236 AAATTCTTAATAATTGAATAGGG + Intergenic
989643461 5:43604547-43604569 TATTTTTGACTGAATGAATAGGG - Intronic
990717201 5:58650499-58650521 ACGGTTTAACTGGTTGAATAAGG + Intronic
991142363 5:63259656-63259678 AACTATTTACTGATTCTATATGG + Intergenic
992075156 5:73185313-73185335 TAATTTTTACTGCTTCAATAAGG - Intergenic
992763880 5:79976642-79976664 AATTTTTTGCTGGTTGAATGTGG - Intergenic
993898488 5:93568745-93568767 TAGTATTTATTGATTTAATAAGG + Intergenic
994435425 5:99724441-99724463 AAATTATTGCTGAATGAATATGG + Intergenic
994981036 5:106875415-106875437 ATGTTTTTTCTGTTTGATTAGGG - Intergenic
995001913 5:107143316-107143338 AAGTTTTTCCTCATCGAATATGG + Intergenic
995017633 5:107329384-107329406 AAGTTTTTCTTGATTCAAAAGGG - Intergenic
995259069 5:110080907-110080929 AAGTTAGTACTTATTGAATCTGG - Intergenic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
997331384 5:133064549-133064571 ACTTTTTTACTTATTTAATAGGG + Intronic
997404846 5:133637378-133637400 AAATTTTTATTGAGTGAATAAGG - Intergenic
998609791 5:143675391-143675413 AACTTTGTACTTAATGAATAGGG + Intergenic
1000230558 5:159311556-159311578 AAGCTTTTACTTATTGGATCAGG + Intergenic
1000278276 5:159759280-159759302 AAGATATTACTAATTGATTAAGG - Intergenic
1000525823 5:162356313-162356335 AAGCTTTTACTCATGGAAGAAGG + Intergenic
1000633090 5:163613321-163613343 AAGTTTTTGCTGTTTGATGAAGG - Intergenic
1000782909 5:165506140-165506162 CAATTTTTACTTCTTGAATAGGG + Intergenic
1003401031 6:5790989-5791011 AATTTTTTAATGATGGAATATGG - Intergenic
1003409852 6:5852461-5852483 AGCCTTTTACTGATTGAATGAGG + Intergenic
1003675833 6:8203539-8203561 AACATTTTACTGAAAGAATATGG - Intergenic
1004254107 6:14047132-14047154 AAGTTTCTACTGAATGGGTATGG + Intergenic
1004868609 6:19879576-19879598 AAGTTTTCACTGACTCAGTAAGG - Intergenic
1005207667 6:23422823-23422845 AATTTTTTCCTGATTTCATATGG - Intergenic
1007194120 6:40045431-40045453 AAGTTTTAACTAAATTAATATGG + Intergenic
1008317651 6:50065959-50065981 AACATGTTACTGACTGAATAGGG - Intergenic
1008884710 6:56419823-56419845 AAGTATTTATTGAATGAATGAGG - Intergenic
1009701526 6:67188841-67188863 AAGTTTTCTCTGAATGTATAAGG - Intergenic
1010065235 6:71674847-71674869 ATGTTTTTACTCATTAAATCTGG + Intergenic
1010084469 6:71900633-71900655 TTGTTTTAATTGATTGAATATGG + Intronic
1010811408 6:80303927-80303949 AAGTTATTAGTAATTTAATAGGG + Intronic
1010813522 6:80327819-80327841 AAGTGTTTAATGATTTCATAAGG + Intronic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1011781928 6:90799339-90799361 GAGTTTTTACTCATGGAAGAAGG + Intergenic
1011807059 6:91083766-91083788 AAGTATTTATTGAATGACTATGG - Intergenic
1011832428 6:91389597-91389619 ATGTTTTGACTTTTTGAATATGG - Intergenic
1012280844 6:97326990-97327012 AAGTATTTACTGATTAAGAAGGG - Intergenic
1012370622 6:98502064-98502086 AATTTTTTTCTAATTGATTATGG + Intergenic
1012556087 6:100513559-100513581 AATTTTTTTCTGAATAAATAGGG - Intronic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1013008510 6:106098212-106098234 AGGTATTGACTGATTGTATAAGG + Intronic
1013147288 6:107406558-107406580 ATGTTTTGAATGATAGAATATGG + Intronic
1014032833 6:116726175-116726197 AAGCTTTTAATGATTTATTAGGG + Intronic
1014117871 6:117686624-117686646 CAGTTATTTCTGAATGAATATGG + Intronic
1014405741 6:121048295-121048317 AAGATTTTACCCATTGAATGGGG - Intergenic
1014457651 6:121654792-121654814 AACTATTTACTGGTTGAAAATGG + Intergenic
1015095540 6:129410561-129410583 AAGTTTATACTGGTTGTATTAGG + Intronic
1015240549 6:131018295-131018317 AAAGTTTTACTCCTTGAATATGG - Intronic
1015543271 6:134337512-134337534 AAGGTGTCTCTGATTGAATAAGG - Intergenic
1015847639 6:137537417-137537439 AAGTTTTTCCTTATTGAGAAGGG - Intergenic
1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG + Intronic
1020663570 7:11011196-11011218 AATTATTTACTAATTGTATATGG + Intronic
1021065324 7:16165872-16165894 AAGATTTTACAGGTTGAAAAGGG - Intronic
1021826601 7:24559044-24559066 CAGTTCTCTCTGATTGAATAGGG + Intergenic
1023383490 7:39631945-39631967 AAGTTTTTACTCATGGAAGAAGG + Intronic
1023478481 7:40606762-40606784 AAGTCATTTCTGATTTAATATGG - Intronic
1023642898 7:42278861-42278883 AAGTTTTGACTTCTTGAATTAGG + Intergenic
1024101088 7:46033526-46033548 TAGGTTTTACTGATTGAAGTGGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1024863140 7:53869734-53869756 GATTTTTTAGTGATTGATTAAGG - Intergenic
1027948105 7:84777121-84777143 AAGCTTTTACTCATTGCAGAAGG - Intergenic
1027978603 7:85187658-85187680 AAGTTCCTACTGTGTGAATAAGG - Intergenic
1028713368 7:93936489-93936511 AGGTTTTCAATGATGGAATACGG + Intergenic
1030531506 7:110716815-110716837 AGGTTTTGACTAATTAAATATGG + Intronic
1030569384 7:111203222-111203244 AAATGTTTATTGAATGAATATGG - Intronic
1031835669 7:126679081-126679103 CAGTCTTTACTGAATTAATAAGG - Intronic
1032622519 7:133550914-133550936 AACTTTTTGCTGACTGAATTGGG - Intronic
1032905232 7:136356976-136356998 AAATTTGTACTGATTTAAGATGG + Intergenic
1034777608 7:153844425-153844447 AAGATTTTACCCATTGAATGGGG + Intergenic
1034910236 7:154990802-154990824 AAGTTTTTAATGGGTGAAAATGG - Intronic
1035059599 7:156059257-156059279 TAATTTTAACTGATTTAATAAGG - Intergenic
1035257066 7:157637101-157637123 AATTCTTTTCTCATTGAATAAGG - Intronic
1040895148 8:52359644-52359666 ATTTTTTTACTACTTGAATAGGG - Intronic
1041108347 8:54462751-54462773 AAGTTTTTACTGTTTTATTTTGG + Intergenic
1041271370 8:56112537-56112559 AAGTTTTTACTGATTTGGTGTGG + Intergenic
1042259836 8:66846981-66847003 AAGTGTTCACTGAATGAATTAGG - Intronic
1042380560 8:68108492-68108514 AAGTGTATACTGAATGAAAATGG + Intronic
1042610928 8:70600384-70600406 AACTTTTTATTCATTGTATAGGG - Intronic
1042756852 8:72223996-72224018 TTGTTTTTATTTATTGAATAAGG - Intergenic
1043639633 8:82435555-82435577 AAGCTTTTACTTATCGAAGAAGG - Intergenic
1044945208 8:97382951-97382973 AAGCTTTTACTCGTGGAATAAGG + Intergenic
1045158245 8:99504230-99504252 AAGCTTTTACTCATGGAAGAAGG - Intronic
1045379683 8:101610921-101610943 AAGTTTGTACTGACTTAAGATGG - Intronic
1046221837 8:111226833-111226855 AAATTTGTACTGATTTAATATGG + Intergenic
1046566155 8:115904031-115904053 AAATATTTATTGATTGATTATGG - Intergenic
1046712772 8:117530387-117530409 AAATATTTGCTGATTGAGTAGGG + Intronic
1046959860 8:120099594-120099616 AATTTCTTTCTGATTGAATCTGG + Intronic
1047233641 8:123019358-123019380 AAGTTTTAACTAATAGCATAAGG + Intronic
1048245283 8:132790138-132790160 AAGATTTTTCTGATTGAATTTGG - Intronic
1049125584 8:140784388-140784410 AAGGTTTTACTGCTTGATCAAGG + Intronic
1049877771 8:145037035-145037057 AAGCTTTTACTCATGGAAGAAGG - Intergenic
1051847656 9:21470628-21470650 AAGTTTTTACCTATACAATATGG + Intergenic
1052401075 9:28000601-28000623 AATGTTTGTCTGATTGAATATGG - Intronic
1052735033 9:32333332-32333354 AACTATTTACTGGTTGAAAATGG - Intergenic
1053187013 9:36024890-36024912 AAGATTCTATTGATTGGATAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054990652 9:71321764-71321786 AAGTATTTGCTGAATGAATAAGG - Intronic
1059525143 9:114984470-114984492 CAGTTTTTACTGACCAAATATGG - Intergenic
1059855413 9:118391908-118391930 AAGTTTTTAATGATCTAATGTGG - Intergenic
1060701662 9:125756961-125756983 AAGTTATTTTTGATTGAAAAGGG + Intronic
1186631456 X:11353502-11353524 AGGTTGTTTCTGATTAAATAAGG - Intronic
1187119771 X:16393239-16393261 AAATTCTTACTGTTTGAACAAGG - Intergenic
1187600311 X:20822049-20822071 AATTTTTTTCTCATTGTATATGG - Intergenic
1188731522 X:33651712-33651734 AAGTTTTTACTGTTAGTACAAGG + Intergenic
1188946549 X:36312132-36312154 AAGGTTTAACTGATAGACTAAGG + Intronic
1189334046 X:40159295-40159317 GAGTTTTTACTGATTTCAAATGG - Intronic
1189734529 X:44056176-44056198 AAGTCTTTATTGATTGAAGCAGG + Intergenic
1193173642 X:78366293-78366315 TAGTATTTACTGAGTAAATATGG + Intergenic
1193551364 X:82896955-82896977 AAGTCTTTACTGACTGGATTTGG + Intergenic
1193969117 X:88029140-88029162 ATGTTTTTACTGATTGACATTGG - Intergenic
1194465068 X:94224188-94224210 AAGTTTTTAATGAGTGAAATAGG + Intergenic
1194621015 X:96172038-96172060 AAATGTTTATTGAATGAATAAGG - Intergenic
1195506795 X:105667221-105667243 AAGATTTTACCCATTGAATGGGG + Intronic
1195605210 X:106798768-106798790 ATATTTTTACTGATTGACTTGGG - Intergenic
1195958769 X:110363426-110363448 AAGTATTTACTGATAGATAAGGG + Intronic
1196384895 X:115138846-115138868 AAGTTTTTACTAATTCAACTCGG + Intronic
1196791880 X:119471160-119471182 AACTATTTACTGGTTGAAAATGG + Exonic
1197360551 X:125497342-125497364 AAGTGTTTACTGATTTAAGTAGG + Intergenic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1199036889 X:143062141-143062163 GAGTTTTTAATGAGTGAAAATGG + Intergenic
1201587509 Y:15577236-15577258 AAGAATCTACTGAATGAATAGGG + Intergenic
1201622392 Y:15974406-15974428 AAGATTTTACCCATTGAATGGGG + Intergenic
1201970693 Y:19790822-19790844 AAGTTTCTAATTATGGAATATGG - Intergenic