ID: 972946490

View in Genome Browser
Species Human (GRCh38)
Location 4:44263106-44263128
Sequence CTGCAGCAACGGAAAGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972946484_972946490 24 Left 972946484 4:44263059-44263081 CCCATGACAAGTCTAAATTTCAC 0: 1
1: 0
2: 1
3: 17
4: 145
Right 972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG 0: 1
1: 0
2: 0
3: 6
4: 129
972946483_972946490 30 Left 972946483 4:44263053-44263075 CCTCTGCCCATGACAAGTCTAAA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG 0: 1
1: 0
2: 0
3: 6
4: 129
972946485_972946490 23 Left 972946485 4:44263060-44263082 CCATGACAAGTCTAAATTTCACT 0: 1
1: 0
2: 0
3: 13
4: 206
Right 972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG 0: 1
1: 0
2: 0
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972946490 Original CRISPR CTGCAGCAACGGAAAGCATA TGG Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
904938452 1:34148394-34148416 GTGCAGCAACAGAAAACAAAAGG + Intronic
910484336 1:87696269-87696291 ATACAGCAACTGAAAGCAAAAGG + Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912254607 1:108046245-108046267 CAGCAGCAAGGCAAAGCACATGG - Intergenic
913150491 1:116037528-116037550 CTGAAGCAAAGGAAAGAATCTGG - Intronic
915715858 1:157944138-157944160 CTGCAGAGAAGGAAAGCATGGGG - Intergenic
915734799 1:158077968-158077990 CTGCAGAAACAGAAAGAATGAGG - Intronic
916289999 1:163155208-163155230 CTGCATCTTTGGAAAGCATAGGG + Intronic
919964966 1:202513728-202513750 CTGAAGCAAAGGCAAGCAAAAGG + Intronic
921450811 1:215303354-215303376 CTCCAGCATAGGAAAGCAAAAGG - Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
1064650136 10:17500616-17500638 ATGCAGCAATGCAAGGCATAAGG - Intergenic
1067756454 10:49009320-49009342 CTGAAGCAAGAGAAAGCAAATGG + Intergenic
1068377306 10:56197472-56197494 CTACAGCAACCAAAACCATATGG - Intergenic
1070925327 10:80217095-80217117 CTGAAACAATGGAAAGCACATGG - Intergenic
1071249960 10:83807515-83807537 CTGCAGCATTGAAAAGCAAATGG + Intergenic
1074025065 10:109625918-109625940 CTGAAGCAATGGAAAGCCTCTGG + Intergenic
1077993030 11:7429030-7429052 CTCCAGCAACAAAAAGCAGAAGG + Intronic
1088342450 11:108783976-108783998 TTGCAGCAAAGGACAGCCTAAGG + Intronic
1091059766 11:132450407-132450429 CTGCTGCACAGGAAACCATATGG + Intronic
1099812996 12:87608673-87608695 CTACAGGAAGGGAAAGCAAAGGG + Intergenic
1100172423 12:91990706-91990728 CTGAAGCAAGGGAAAGGAAAGGG - Intronic
1100239186 12:92693830-92693852 CTCCAGGAAAGGAAAGCATGTGG - Intergenic
1100767757 12:97886600-97886622 CTGCAGAAATGGTAAGCATATGG + Intergenic
1110712734 13:78667412-78667434 CTGCAGCACCCGAAAGCTAAGGG + Intergenic
1111468110 13:88643930-88643952 CTGGTGCAACTGAAAGCATCTGG + Intergenic
1112298669 13:98210935-98210957 CAGCAGCAATGGAAATCAAAAGG - Intronic
1114214136 14:20643027-20643049 CTGCAGCTACAGAAAGATTATGG + Intergenic
1114775192 14:25473644-25473666 CTACAGGAAAGGAAAGCCTATGG + Intergenic
1115532576 14:34340921-34340943 CTGAGGCTACGGAAAGAATAGGG + Intronic
1115534682 14:34362097-34362119 GTGCAGCAATGGAAGGCTTATGG - Intronic
1119689272 14:76658121-76658143 GTGCAGGACAGGAAAGCATAAGG - Intergenic
1121745090 14:96282479-96282501 CTGAAGCAAAGCAAAGCAGAGGG + Exonic
1122849907 14:104522568-104522590 CTGCAGCCAGGGAGAGGATAAGG - Intronic
1122870115 14:104634614-104634636 CTGCAGCACAGGAAAGGTTATGG - Intergenic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1126521789 15:49603893-49603915 CAGCATCAGCGGAAATCATATGG + Intronic
1130780397 15:87032036-87032058 CTGCAGCATGGGAGAGAATATGG + Intergenic
1130881420 15:88059131-88059153 CAGCAGCAATGGCAAGCAGAGGG + Intronic
1133835357 16:9362804-9362826 GTGCAGGAGAGGAAAGCATAAGG - Intergenic
1134296805 16:12953483-12953505 CTTAACCAACAGAAAGCATAAGG + Intronic
1136685979 16:31995189-31995211 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136786591 16:32938722-32938744 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136883178 16:33915072-33915094 CTGCAGAACCAGAAGGCATAAGG + Intergenic
1137903781 16:52298085-52298107 CTGCCTCAAAAGAAAGCATAGGG - Intergenic
1138524411 16:57593700-57593722 CTGCAGCCTCCAAAAGCATAAGG + Intergenic
1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG + Intergenic
1140725119 16:77804954-77804976 CTGCAGCCACGGGAGACATACGG - Intronic
1203088826 16_KI270728v1_random:1200388-1200410 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142772669 17:2110603-2110625 AAGCAGCAAAGGAAAGCAGACGG + Intronic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1145192348 17:20853972-20853994 TTGCAACAGAGGAAAGCATATGG + Intronic
1146239342 17:31202436-31202458 CTGCAGGAATGGATAGAATATGG - Intronic
1147146939 17:38490854-38490876 CTGCAGAACCAGAAGGCATAAGG - Intronic
1148908013 17:50923446-50923468 CTGCAGCCACAGAAACCAAAAGG + Intergenic
1149571552 17:57675757-57675779 CTGCAGCTAAGGAACGCAAATGG - Intronic
1151317042 17:73329393-73329415 CAGCAGCACCGGAAGGCACAGGG + Intergenic
1151657084 17:75501171-75501193 CTGCAGCAAGGGGAAGGATGCGG + Intronic
1161436681 19:4267737-4267759 CTGCAGCAACGGGCAGCCTCAGG + Exonic
1164156594 19:22601209-22601231 CTGCAGCAGCAGGAAGCTTAGGG + Intergenic
1165381106 19:35481026-35481048 CTGATGCAACAGAAAGCACAGGG - Intergenic
931296958 2:60936895-60936917 CTGCTGCAACGGAAGGAATTGGG - Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
936462098 2:112721690-112721712 CTGCAGCTGCAGAAAGCACAGGG - Intronic
938696964 2:133843175-133843197 CTGCTGGAACAGAAAGCATTTGG + Intergenic
941447213 2:165617401-165617423 CTACAGCCAAGGAAATCATATGG - Intronic
943520077 2:188938226-188938248 CTTCAGAAACGGGAAGAATAGGG - Intergenic
946811245 2:223528332-223528354 CTAAAGCAACAGAAAGCAGATGG - Intergenic
1170408927 20:16067563-16067585 TTGCACCAACTGAAAGTATATGG + Intergenic
1172936586 20:38624810-38624832 CTGCAGCAACGAACAGAGTAGGG - Intronic
1174183871 20:48691782-48691804 CTGCAGCAATGGAAACCAACAGG + Intronic
1175840773 20:62025812-62025834 CTGCAGTGACAGAAAGCAGATGG + Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183959233 22:41401218-41401240 GTGCAGCCACGGCAAGCACAGGG + Intergenic
1184432369 22:44449047-44449069 CTGGAGCAACAGAAAGCACGGGG - Intergenic
949454909 3:4228054-4228076 CTGCAGGAACTAAAAGCAGAAGG + Intronic
955949827 3:64231897-64231919 CTGAAGTAAAGGAAAGAATATGG - Intronic
955956013 3:64291135-64291157 CAGCAGCAATGCAAAGCTTAGGG + Intronic
956552332 3:70475159-70475181 CAGCAGCAACCGAAGCCATAGGG - Intergenic
956558040 3:70543042-70543064 CTGCAGCAACTGAAGGCATCTGG - Intergenic
956578404 3:70781631-70781653 CTCCAGCAACTGAAAGGAAAGGG + Intergenic
956692762 3:71892972-71892994 CTGCAGCAAAAGGAAGCCTAGGG + Intergenic
958456328 3:94336315-94336337 CAGCAGCAATGGAAAGCAGCTGG + Intergenic
968547929 4:1208063-1208085 CTGCAGCAAAGAAAACCATCTGG - Intronic
968675205 4:1874088-1874110 CAGCAGCAACAGAAGCCATAAGG + Intronic
972647774 4:40985476-40985498 ATGCAGCAACAGAGAGCACAGGG + Intronic
972946490 4:44263106-44263128 CTGCAGCAACGGAAAGCATATGG + Intronic
973535766 4:51880505-51880527 CAGGAGCCACGGAAAGCAGAGGG - Intronic
979010017 4:115355471-115355493 CTGCAGCAAGGGAGACCACATGG - Intergenic
981180667 4:141739836-141739858 CTGCATCAATGGAAATCATATGG - Intergenic
986764806 5:10915720-10915742 CTGCAGCAAGCAATAGCATATGG - Intergenic
996230913 5:121062126-121062148 CTGCACCAAAAGAAAGAATAAGG - Intergenic
996815287 5:127567177-127567199 CTCCAGAAACAGAAGGCATATGG + Intergenic
999336734 5:150725757-150725779 CCTCAGCAAGAGAAAGCATAGGG + Intronic
1001701939 5:173713012-173713034 CTGCAGCGAGGCAGAGCATAGGG + Intergenic
1002307557 5:178292750-178292772 CTTCAGCAACTGAAAGGATGGGG + Intronic
1003330562 6:5125113-5125135 CTGCAGCCACGGTAAGGAGAAGG + Intronic
1003777597 6:9386220-9386242 TTGCACCAAAGGAAAACATATGG - Intergenic
1005092432 6:22071692-22071714 CTGAAAGAACGGAAACCATATGG - Intergenic
1005812347 6:29527406-29527428 CTGCAACAACGCAAAGCTTGTGG - Intergenic
1011454309 6:87530745-87530767 CTGCATCATGGGAAAGCAGAAGG + Intronic
1014353773 6:120377868-120377890 CTGCAGCAATAGAACGTATAAGG + Intergenic
1015738757 6:136430715-136430737 CTGCAGCACAGGACAGCATGGGG - Intronic
1018411602 6:163554400-163554422 CTTAAGCATTGGAAAGCATATGG + Intronic
1019693260 7:2429679-2429701 CTGCAGCCATTGAAAGGATAAGG - Intronic
1021028479 7:15699691-15699713 CTGCAGTAAGGTGAAGCATATGG + Intergenic
1022190905 7:28016134-28016156 CTGCAGCAAAGAAAGGCAGAGGG - Intronic
1023952909 7:44861397-44861419 TTGCAGGGACGGAAAGCATTAGG - Intergenic
1026535523 7:71235748-71235770 CTCCAGCACCGGGAAGCATGAGG + Intronic
1033268387 7:139907965-139907987 CTGCAGCTACTAAAAGGATAAGG - Intronic
1038464752 8:27751209-27751231 CAGCAGCAATGGAAGGGATAAGG + Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043389636 8:79779855-79779877 CTTCAGGAATGGAAAGAATAAGG + Intergenic
1045225689 8:100243157-100243179 CTGTAGCAACGGAAACGATCAGG - Intronic
1046735631 8:117773511-117773533 CTGCATTAACAGAAAGCATTAGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1056644285 9:88397360-88397382 CTGGAGCAAAGGAAAGCAAGGGG - Intronic
1058828169 9:108793457-108793479 CTGGGGCAACTGAAAGCATCTGG + Intergenic
1191871579 X:65750876-65750898 CACCAGAAACGGAAAGCATGTGG + Intergenic
1202300594 Y:23409555-23409577 CTGAAGCAAGGGCAAGCAAAAGG + Intergenic
1202570217 Y:26261043-26261065 CTGAAGCAAGGGCAAGCAAAAGG - Intergenic