ID: 972947898

View in Genome Browser
Species Human (GRCh38)
Location 4:44280523-44280545
Sequence AAGCTGCTCCAGAGTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972947898 Original CRISPR AAGCTGCTCCAGAGTGAAGA AGG Intronic
900757096 1:4443548-4443570 CTGCTGCTCCAGGGTGAAGTGGG - Intergenic
900794151 1:4697951-4697973 ACGCTGGTGCAGAGTGAAGCTGG - Intronic
901961342 1:12828691-12828713 CAGCTCCTCCAGGGTGGAGACGG + Exonic
901969468 1:12895755-12895777 CAGCTCATCCAGGGTGAAGATGG + Exonic
902015704 1:13306025-13306047 CAGCTCATCCAGGGTGAAGATGG - Intronic
902030155 1:13416425-13416447 CAGCTCCTCCAGGGTGGAGATGG - Exonic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903001464 1:20269121-20269143 GAGCTGGTCCAGATTCAAGAAGG - Intergenic
903279506 1:22242519-22242541 AAGCTGCTCTGGAGTGGAGGTGG + Intergenic
904390667 1:30183836-30183858 AAACTGGTCCAGAGTGATTAAGG + Intergenic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
905104517 1:35556834-35556856 AAGTTGGTGCAGAATGAAGAGGG - Intronic
907559929 1:55379000-55379022 AAGATGCTCCAGGATGAACAGGG - Intergenic
907835236 1:58102391-58102413 AAGCAGCTTCAGAGTGAAACTGG + Intronic
907943187 1:59108340-59108362 AAGTTACTCAAGAGAGAAGAGGG + Intergenic
908849921 1:68365259-68365281 GAGTAGCTCCAGAGTGATGAAGG - Intergenic
909467584 1:75990588-75990610 AAGCCTCTCAAGAGTGAAGATGG + Intergenic
910344912 1:86225490-86225512 AGGCAGCTCCAGAGGCAAGAGGG + Intergenic
911167473 1:94736899-94736921 ATGGTGCTCAACAGTGAAGAAGG - Intergenic
912389039 1:109289023-109289045 AGGCTGCTCCAAGGGGAAGAAGG - Intergenic
912401843 1:109399676-109399698 AAGCTGATACAGTTTGAAGAAGG - Exonic
912666834 1:111588637-111588659 AAGCTGGGCCAGAGATAAGAAGG - Intronic
912822737 1:112880852-112880874 AAGCAGCTTCAGAGTGGGGAGGG + Intergenic
914456389 1:147841032-147841054 CAGCTCCTCCAGGGTGAAGATGG - Intergenic
914790783 1:150876192-150876214 AAGCGGCTCCAGCGGGCAGAGGG + Intronic
915953646 1:160205975-160205997 AAGCTTGTCCAGAGGGAAGGAGG + Intronic
916300351 1:163266957-163266979 AAGGTGCTCCAGAGAGAAAGAGG + Intronic
917369324 1:174272788-174272810 AAGCATCTCCAGAGTGAATATGG + Intronic
918598974 1:186330502-186330524 ACGCTGCCCCAAAGTGAACATGG + Intronic
919353018 1:196484011-196484033 AAGGTGTGTCAGAGTGAAGAGGG + Intronic
920701952 1:208224682-208224704 ACCTTGCCCCAGAGTGAAGAAGG + Intronic
921273011 1:213489562-213489584 GAGCTCCTCCAAAGTGAGGATGG - Intergenic
921447310 1:215261871-215261893 CAGATGCTTCAGAGTGATGAGGG + Intergenic
921658448 1:217769259-217769281 AATGTGTTCCAGAATGAAGATGG + Intronic
922609013 1:226910728-226910750 CAGGTGCTCAAGAGCGAAGATGG - Exonic
923964387 1:239120926-239120948 AACCTGCTCCAGAATGTACAGGG - Intergenic
1062979078 10:1707008-1707030 TACCCGGTCCAGAGTGAAGAGGG + Intronic
1064605155 10:17031522-17031544 TACCTGCTTCAGAGTGAAGCAGG - Intronic
1064990799 10:21255093-21255115 AAGCTGCTTGAGTCTGAAGATGG + Intergenic
1066380135 10:34894066-34894088 AAGCTGATCAAGGGTGAAAATGG + Intergenic
1068272162 10:54742459-54742481 ATGCTACTCAAGACTGAAGAAGG + Intronic
1071467118 10:85951319-85951341 AAGCAGCACCAGTGTGCAGAGGG + Intronic
1071954027 10:90737258-90737280 GAGGTGATGCAGAGTGAAGAGGG - Intergenic
1072426623 10:95335891-95335913 TAGCTGACCCAGAGAGAAGATGG + Intronic
1072621308 10:97081293-97081315 AAGCTTCTCCAGGGAGAAGCTGG + Intronic
1073352767 10:102831609-102831631 ATGCTGCTCCAGAGTGGAAGAGG + Exonic
1073599922 10:104836625-104836647 AAGCTCTACAAGAGTGAAGAGGG - Intronic
1073819739 10:107247882-107247904 AACATGCTCCAGAGGGAAGAAGG + Intergenic
1074184876 10:111092525-111092547 AAACAACTACAGAGTGAAGATGG + Intergenic
1075585261 10:123652637-123652659 AAGCTGATCAAGAGGGGAGAAGG + Intergenic
1076239230 10:128891394-128891416 AAGCAGCTTCAGAGTGGAGGAGG + Intergenic
1076695996 10:132247651-132247673 AAGCTGGTCCTGGGTGAAGTGGG + Intronic
1077148193 11:1055264-1055286 ACGCTGCTCCAGGGGAAAGAAGG + Intergenic
1078263374 11:9733075-9733097 AAGGTACTCATGAGTGAAGATGG - Intronic
1078820193 11:14872267-14872289 AAGCTGCTCTAGAGTGTGTAGGG + Intergenic
1079087065 11:17454135-17454157 GAGCTGCTGCAGGGTAAAGAGGG + Intronic
1080030830 11:27658871-27658893 AAGCTGCTAAAGTGGGAAGAAGG - Intronic
1081128191 11:39344348-39344370 AAGCTGTGCCAGATTGAAGAAGG + Intergenic
1081228135 11:40550836-40550858 AACCTGCTCCTGATTGAAGTTGG + Intronic
1081712771 11:45227936-45227958 AAGCTGCTCCAGGGTCAGGCGGG - Intronic
1082909388 11:58353448-58353470 ATGCTGCTCAAGAATGAAAAAGG - Intergenic
1083459799 11:62803467-62803489 GAGCTCCTCCAGAGAGAGGAGGG - Exonic
1084094400 11:66901342-66901364 AAGCTGGTAGAGAGTGAGGAAGG - Intronic
1085458832 11:76680985-76681007 AAGTTGTTCCAGAGTGAACCAGG - Intergenic
1086644828 11:89207565-89207587 AATCTGTTCCAGAATGTAGAAGG + Intronic
1089109277 11:116042254-116042276 GAGAGGCTCCAGAGTGAGGATGG - Intergenic
1090012512 11:123057828-123057850 AAGCTGTACCAGAGTGCAGGAGG - Exonic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1091895433 12:4099407-4099429 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
1093375641 12:18424080-18424102 AAGCTGCCCCATAGAGAAGGTGG - Intronic
1093584661 12:20821454-20821476 AAGCTAGTCCATAGTGAAGGAGG + Intronic
1093650652 12:21641467-21641489 AAACTGTTCCAGAATGAAGGAGG + Intronic
1094200165 12:27787045-27787067 TATCTTCTCCAGAGTGCAGAAGG - Intronic
1097130262 12:56806319-56806341 GACCTGCTCCAGAGTCCAGAAGG + Intergenic
1100614634 12:96221481-96221503 AATCTGCTCCTGAGGGCAGAAGG - Intronic
1100837673 12:98582363-98582385 GAACTGCTTCAGACTGAAGAAGG + Intergenic
1102001637 12:109561248-109561270 ACGCTGCTCCAGAGTGGGCAGGG + Intronic
1102455274 12:113066982-113067004 GAGCAGCTCCAGAGGGATGATGG - Intronic
1103785595 12:123430585-123430607 TAGCTCCTGCAGAGTGAAGCGGG + Exonic
1103911878 12:124356455-124356477 AAGCTGCCCCAGGGTTGAGATGG - Intronic
1103923642 12:124412113-124412135 AAGGTGGGCCAGAGTGAAGGCGG + Intronic
1104751823 12:131244940-131244962 AAGGGGCTCCAGCGTGAAGGAGG - Intergenic
1104780070 12:131414135-131414157 AAGGGGCTCCAGTGTGAAGGAGG + Intergenic
1105272263 13:18888418-18888440 AAGATGCTCCAGGGTAAAAAGGG + Intergenic
1106901330 13:34357485-34357507 AAGCTGCTCCAGCGTGAGTTAGG - Intergenic
1107220439 13:37973653-37973675 AAGCTTGTCCATAGTGAAGAAGG + Intergenic
1107483170 13:40802223-40802245 AAGCTGCTAAGGAGTGAAGTGGG + Intronic
1108439460 13:50435833-50435855 AAGCTTGATCAGAGTGAAGAAGG + Intronic
1109620552 13:64899897-64899919 CAGCTGCTCTGGAGTGAAGTAGG + Intergenic
1111054351 13:82928423-82928445 TAGCTGCTTCAGAGTGTAGAGGG + Intergenic
1112631249 13:101163601-101163623 AAGCTGCTCCAGGGTGGCGCAGG + Intronic
1114459755 14:22878891-22878913 AAGCTGCCCCAGAGTTTGGAAGG + Exonic
1118579609 14:67281191-67281213 AAACTGCTCCAGACTTGAGACGG - Intronic
1118639121 14:67776026-67776048 CAGCTGCTCCAGCATGAACAGGG + Exonic
1119079781 14:71681566-71681588 ATACTGCTTTAGAGTGAAGAGGG + Intronic
1121546808 14:94769057-94769079 GAGCTGCTCGTCAGTGAAGATGG + Exonic
1121982697 14:98468569-98468591 CAGCTGCACCAGAATGAATAGGG - Intergenic
1124867676 15:33509271-33509293 AAACTCCTCTAGAATGAAGAGGG + Intronic
1124891816 15:33740705-33740727 AAACTGCTTCAGAGTGAGCAGGG + Intronic
1126350714 15:47742442-47742464 AAGCTGCCCAAGGGAGAAGAGGG - Intronic
1128867993 15:71130021-71130043 GAGCTGTTCCAGAGTGAATGGGG + Intronic
1129425533 15:75459754-75459776 AAGCTGATCCACAGATAAGAAGG - Intergenic
1131925807 15:97382769-97382791 TAGCTGCCCCAGAGTGGATAGGG + Intergenic
1134023204 16:10935879-10935901 GAGCTGATCCAGACTGAAGAAGG + Intronic
1134750498 16:16621116-16621138 AAGCAGCTCAAGAGCCAAGAGGG - Intergenic
1134994956 16:18732474-18732496 AAGCAGCTCAAGAGCCAAGAGGG + Intergenic
1138819647 16:60243579-60243601 AAGCTGCTCCAGCCAGATGAGGG + Intergenic
1139264433 16:65625679-65625701 GAGTTGCTCCAGCGTGAAGCAGG - Intergenic
1139792121 16:69446805-69446827 AAACTGTTCCAGATTGAAGGAGG - Intronic
1140222691 16:73055590-73055612 AAGCTGCTCCATATTTAATAGGG + Intronic
1140703549 16:77604992-77605014 AAGCTGCTCTGGAGCTAAGAAGG - Intergenic
1142528262 17:560483-560505 GAGCTCCTCCAGAGTGAACTTGG + Exonic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145991084 17:29079856-29079878 CAGCTGCTCCAGTGTGAAGAAGG - Intronic
1146497289 17:33334415-33334437 AAGCCGCTGCAGAGAGAAGTAGG - Intronic
1148842991 17:50511038-50511060 AACATGCACCAGAGTGAGGAGGG + Intronic
1157089042 18:44613670-44613692 AGGCAACTCCAGAGGGAAGACGG - Intergenic
1158696699 18:59709984-59710006 AAGCTGCACCAGGTTGGAGAAGG - Intergenic
1159844236 18:73439783-73439805 AAGCTGGTACAATGTGAAGAGGG + Intergenic
1160244593 18:77146863-77146885 AAGCTGCTCCAATTTGCAGAAGG - Intergenic
1161318011 19:3627246-3627268 AGGCAGCTCCAGAGGGCAGAGGG + Intergenic
1161806520 19:6446629-6446651 ATGCTGCACCAGAGAGATGAGGG - Intronic
1165335762 19:35168624-35168646 TGGCTGCTCCAGAGTGAGGGAGG - Intronic
1165565080 19:36718774-36718796 AAACTGCTTCAGAGTGGAAAAGG - Intronic
925364464 2:3302550-3302572 AAGCTGATCCTGAGTGCAGTTGG + Intronic
926044194 2:9697701-9697723 CAGGTGCTCATGAGTGAAGAGGG + Intergenic
926239001 2:11070463-11070485 AACCTGCTTCAGATTGAAGCGGG - Intergenic
927597481 2:24409294-24409316 AGGCTGCTCCTGAGGGCAGAGGG - Intergenic
927626446 2:24725387-24725409 AACCTGACCCAGAGAGAAGAGGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928445591 2:31331146-31331168 AACCTGCCCAAGAGGGAAGAGGG + Intergenic
928976835 2:37096545-37096567 AATTTGTTCCAAAGTGAAGAGGG - Exonic
928997639 2:37310930-37310952 TAACTGCTGCAGAGTGAAGAGGG + Intronic
929234308 2:39590270-39590292 AGGCTGGCCCAGAGTCAAGATGG + Intergenic
930861141 2:56074197-56074219 AAGCTGCCCCAGGAAGAAGATGG - Intergenic
931663674 2:64594456-64594478 AAGTTCCTGCAGAGTTAAGAGGG + Intergenic
932118181 2:69072857-69072879 AAGCAACTCCAGCATGAAGAAGG - Intronic
934111907 2:88751685-88751707 GAGCACCTCCAGAGTGAAGAGGG - Intergenic
934544175 2:95200934-95200956 AAGCTTCACCTGACTGAAGAAGG + Intergenic
936046090 2:109188987-109189009 AAGCTGCTTCTGAGGGAAGCAGG + Intronic
936274708 2:111084551-111084573 ATGTTGCTTCAGAGAGAAGATGG - Intronic
937386406 2:121437642-121437664 AACCAGCACCAGAGTTAAGATGG + Intronic
937393342 2:121512665-121512687 CAGCTCCTCCAAAGTGAAGCTGG + Intronic
937835805 2:126469308-126469330 AGGCTGCTGCAAAGTGATGAGGG - Intergenic
940339381 2:152563865-152563887 AAGCTGCTCCAGAGGCAAGAGGG - Intronic
940491975 2:154374095-154374117 ATACTGCACAAGAGTGAAGAAGG - Intronic
940928308 2:159393851-159393873 AAGCTGCTGCAGAGAGGTGAAGG - Intronic
941261151 2:163299107-163299129 AAGCTGCTCCTTAGGGAAGTAGG - Intergenic
941502904 2:166302951-166302973 AAGCTGCTACAGTGTGAATTTGG - Intronic
942701604 2:178717483-178717505 AAGCTGCTTTACAATGAAGAGGG + Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
946028825 2:216689436-216689458 AAGCGGCCCCAAAGTGGAGAGGG - Intronic
946164792 2:217857406-217857428 ATGCTGCTTCAAGGTGAAGATGG + Intronic
946255764 2:218440786-218440808 TAGCTGCTCCAGGGGGAAGATGG - Exonic
947126530 2:226874463-226874485 AAACTGCTCTAGAGTCTAGAGGG - Intronic
1171081359 20:22188522-22188544 TACCTGCTCCAGAGTGATCACGG - Intergenic
1172518711 20:35553709-35553731 AGCTTCCTCCAGAGTGAAGAGGG - Intronic
1172682333 20:36726363-36726385 AAGCTGCTCCAGGGTGACTCAGG + Intronic
1172827995 20:37806624-37806646 ACCCTGCCCCAGAGTGAACATGG - Intronic
1173174508 20:40754354-40754376 AAACTTCTCCACAGTGCAGAGGG + Intergenic
1173562824 20:44018370-44018392 GAGCTGCTCCTGAGTCATGAGGG + Intronic
1173811593 20:45959267-45959289 AATCTGCTGCAGAGAGAAGAAGG + Exonic
1173854975 20:46244404-46244426 TCCCGGCTCCAGAGTGAAGAGGG + Intronic
1178763055 21:35422502-35422524 AAGCTTCTCCACACTTAAGAAGG + Intronic
1179816822 21:43911649-43911671 CAGCAGCTCCAGAGTGGAAAAGG - Intronic
1180041014 21:45280106-45280128 AAACTGCTCCAAAATGAACACGG + Intronic
1180980340 22:19875423-19875445 AAGCTACTCACGATTGAAGAGGG + Intergenic
1182573622 22:31258111-31258133 AAGCTGGTTCAGACTGAACAAGG - Intronic
1183047679 22:35233323-35233345 AAGTTCCTCCAAAGAGAAGAGGG + Intergenic
1183668997 22:39261182-39261204 AAGGTCCTCCACAGGGAAGATGG - Intergenic
1184288749 22:43487004-43487026 AGGATGGTGCAGAGTGAAGAGGG + Intronic
1184906118 22:47487910-47487932 AAGCTTCTACAGCGTGAAAAGGG + Intergenic
1185139157 22:49090626-49090648 AAGGTGCTGCAGAGTGAGGCTGG + Intergenic
1185242031 22:49751843-49751865 AAGCTGCTCCAGGGAGGAGAGGG + Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950659778 3:14460056-14460078 AAACTGAGGCAGAGTGAAGAAGG - Intronic
951651590 3:24956883-24956905 AAGCTGGACCAGAGAGAAGGAGG + Intergenic
955652279 3:61208075-61208097 AACCTGCTCCTGAGTGACTATGG - Intronic
956193114 3:66625872-66625894 AAGCAGCTTCAGATGGAAGAAGG - Intergenic
956845876 3:73182196-73182218 AATTTGTTCCAAAGTGAAGAGGG + Intergenic
956942643 3:74181487-74181509 AAGCTCCTCCTGGGTGAAAATGG - Intergenic
957616178 3:82530441-82530463 AAGCTTTTCCAGAGTGACCAGGG + Intergenic
959959755 3:112284741-112284763 AAGCTGACCCAAAGTTAAGAAGG + Intronic
959993049 3:112649697-112649719 AGGCAGATCCAGAGTGAAGAGGG - Intergenic
960000546 3:112726992-112727014 AATCTGCTCCTGAATGAATATGG + Intergenic
960327933 3:116319873-116319895 CAGCTGCTCCCCAGGGAAGATGG + Intronic
962187022 3:133270910-133270932 AAGCTGCACCAGAGTGAGTGAGG - Intronic
962689724 3:137882121-137882143 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
965336183 3:167432446-167432468 AAGCTTGTCCATAGTGAAGGAGG - Intergenic
965857683 3:173108487-173108509 AAGCTGCTCCATAGTCAACCTGG + Intronic
966675321 3:182579959-182579981 AAGCAGCTAAAAAGTGAAGAAGG - Intergenic
967561244 3:190921363-190921385 AAGCTTATCCATAGTGAAGGAGG - Intergenic
968874536 4:3258458-3258480 ATGCTGCTCCAGCCTGGAGAAGG - Intronic
969281865 4:6176246-6176268 CAGCTGCTCCAGAGTCAACATGG + Intronic
970218353 4:13782493-13782515 GAACTGCTCCAGGTTGAAGAAGG - Intergenic
971515262 4:27477646-27477668 ACGCTGCTACATTGTGAAGACGG + Intergenic
971567951 4:28168872-28168894 AAGTTGCTGCATAGTGCAGACGG - Intergenic
972947898 4:44280523-44280545 AAGCTGCTCCAGAGTGAAGAAGG + Intronic
975854246 4:78606276-78606298 AAGGTGATCCAGGATGAAGAGGG + Intronic
976942846 4:90727575-90727597 AAAATGCTCCACACTGAAGATGG + Intronic
980284805 4:130768590-130768612 AAGCTTGCCCATAGTGAAGAAGG - Intergenic
980741984 4:136963385-136963407 AAGTTGCTCCAGAGAGAAGGAGG + Intergenic
980918701 4:139060421-139060443 AAACTGCTCCAGAGCAGAGAAGG - Exonic
983488408 4:168359164-168359186 ACTCTGCTCTAGAGTGAATAAGG - Intronic
985048515 4:185966285-185966307 ATGATGCTTCAAAGTGAAGACGG - Intergenic
985607508 5:865980-866002 AACCTGCTCCACAGTGAACTGGG - Intronic
985668633 5:1195175-1195197 AAGCTGCCCCAGATTTCAGAAGG + Intergenic
985946893 5:3192599-3192621 AGGCTGCACCACAGTGAAGATGG - Intergenic
986034799 5:3927380-3927402 AAGCTAGGCCAGAGTCAAGAGGG - Intergenic
989219025 5:38934450-38934472 AAGCTGCTCCAGAGCCAACACGG - Exonic
989326256 5:40199221-40199243 GAGCTGCTCCAGAGTCATGAGGG + Intergenic
989920780 5:49800077-49800099 AAACTGCTCCAGAATAAGGAAGG - Intergenic
990162590 5:52958497-52958519 AAACGGTTCTAGAGTGAAGAGGG - Exonic
990940682 5:61200335-61200357 TAGCTGCTCCTCAGTGGAGAGGG + Intergenic
992080504 5:73231538-73231560 AAGCAGCTGGAGAGAGAAGAGGG + Intergenic
992828648 5:80572861-80572883 AAGGTCCTCCAGAGTGAGGCAGG - Intergenic
994613510 5:102075957-102075979 AAGCTGCAACAGAGTTGAGAAGG + Intergenic
994613655 5:102077573-102077595 CAGCTGCTGCAGAGTTCAGAAGG + Intergenic
997476006 5:134142925-134142947 AGGCTGCACCAGGCTGAAGATGG - Intronic
998424874 5:142018085-142018107 AGGCTGCTCCAGTGTGGAAATGG - Intergenic
999007593 5:147999915-147999937 AAGCTGCTGCAGAGAGAAATGGG + Intergenic
1000417164 5:160995317-160995339 AAGCTGATTCAGAGTGTACATGG - Intergenic
1001520009 5:172384826-172384848 AATCTGCTCCAGACTCAAAATGG + Intronic
1002396639 5:178961381-178961403 AAGCTAATACAGAGTGAAAATGG - Intronic
1002889195 6:1318579-1318601 AAGCTAGTCCTGAGTGAAGCAGG - Intergenic
1002914006 6:1514416-1514438 AAACTGCTCCAGAGCAGAGAAGG - Intergenic
1003777866 6:9389703-9389725 AATCTGCTGGAAAGTGAAGATGG + Intergenic
1005776997 6:29144566-29144588 AAGCTACACTAGAATGAAGATGG - Intergenic
1006616324 6:35330022-35330044 AACCTGCCCCAAAGTGAACATGG - Intergenic
1009622102 6:66090678-66090700 AATCTGCTCAAGAATGAGGAGGG - Intergenic
1010722499 6:79299792-79299814 CAGTTGCTTCAGAATGAAGAGGG + Intergenic
1012449332 6:99338623-99338645 AATCTGTTCAAGAGTGATGATGG + Intronic
1012581667 6:100877757-100877779 TATCTGCTCCAGAGTGAATGGGG + Intronic
1013961164 6:115902099-115902121 CAGCAGCTCCAGATGGAAGATGG + Intergenic
1014102543 6:117527751-117527773 AAGGTGCTGTAGAGTGGAGATGG + Intronic
1014249075 6:119097666-119097688 AAGCAGCTTCAGGGTGAAAAAGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1017085003 6:150705603-150705625 AAGCTACTCCAGACTGGAGGTGG - Intronic
1017649646 6:156569064-156569086 CAGCTGGCCCAGAGTCAAGACGG + Intergenic
1018247798 6:161839223-161839245 AAGGTGCCCCTGAGGGAAGAAGG + Intronic
1018278380 6:162157475-162157497 AAGCTGCTCCAGCTGAAAGATGG + Intronic
1018736083 6:166688172-166688194 CAGCTGCTCCACAGTGAACCTGG - Intronic
1019147412 6:169984203-169984225 GAGCAGCTCCAGGGTGACGAGGG + Intergenic
1019403468 7:869434-869456 GATGTGCTCCAGAGTGAAGGCGG - Exonic
1020615371 7:10453135-10453157 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1021224298 7:18010193-18010215 AACCTGCTCCTGAGTGACTACGG - Intergenic
1021552403 7:21885307-21885329 AAGATGCTCCAGGGTGAACCTGG + Intronic
1022077267 7:26984499-26984521 AAGGTACTACACAGTGAAGATGG + Intronic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023822548 7:43988156-43988178 AGGCTGCTCCAGCGTGAAGGTGG + Intergenic
1024704937 7:51946861-51946883 AGGCTGTTCGAGACTGAAGATGG - Intergenic
1024741268 7:52357656-52357678 CATCTGCTGAAGAGTGAAGACGG - Intergenic
1025617826 7:63139299-63139321 AAGATGGTTCAGGGTGAAGATGG - Intergenic
1027985048 7:85276859-85276881 ACTCTGCTCCAAAGTGAACATGG - Intergenic
1029750811 7:102541571-102541593 AGGCTGCTCCAGCGTGAAGGTGG + Exonic
1029768766 7:102640682-102640704 AGGCTGCTCCAGCGTGAAGGTGG + Exonic
1030441836 7:109596512-109596534 AAGCTTGTCCATAGTGAAGGAGG + Intergenic
1033245018 7:139710605-139710627 TATGTGCTCCAGAGTGCAGAGGG - Intronic
1036864448 8:12382363-12382385 AAGATGCTCCACAGTGAGAAAGG + Intergenic
1038744055 8:30240881-30240903 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1040422426 8:47252547-47252569 AAGCTGATCCTGAGTGGATAGGG + Intergenic
1040603681 8:48909577-48909599 AACCTGCTCCTGGGGGAAGATGG - Intergenic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1042055255 8:64757660-64757682 AAGTTGCACCTGAGTGAAGCTGG - Intronic
1044492374 8:92834621-92834643 AGCCTTCTCCAGAGTGGAGAAGG - Intergenic
1044867935 8:96590678-96590700 TATCTGCTACAGAGTGAAAAGGG + Intronic
1046628545 8:116600980-116601002 AAGCTCCTCCAGAGCCAACATGG + Intergenic
1049573278 8:143379378-143379400 GAGCTGCTCCAGTGCGCAGAGGG - Exonic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1052705841 9:31992570-31992592 AACCTGCTCCAGAATGACTACGG + Intergenic
1053422473 9:37988145-37988167 AAGCAGTTCCAAAGTGAAGAAGG - Intronic
1055856518 9:80694493-80694515 AAGCTGCACCAAAGAGAAGAAGG + Intergenic
1057220348 9:93254318-93254340 GAGCTGCTCACGAGGGAAGAAGG - Intronic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057489093 9:95508167-95508189 AATCTGCTCCAGAGCGAAGGCGG + Exonic
1058268549 9:102938910-102938932 AAGTTCCTCCACAATGAAGAGGG - Intergenic
1059326050 9:113504576-113504598 AAACCTCTCCAGAGTGAAGCAGG - Intronic
1060451990 9:123751288-123751310 AAAGTGCTCCAGAAGGAAGAAGG + Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185506403 X:634705-634727 CAGCTGCTCCAGCGTGAAGTTGG - Exonic
1186071739 X:5828277-5828299 ACACTGCAGCAGAGTGAAGAGGG + Intergenic
1186444576 X:9615855-9615877 AAGGTGCTACGCAGTGAAGAAGG - Intronic
1186514502 X:10156608-10156630 AAACTGCTCCAGGATGAAGAAGG + Intergenic
1186612333 X:11149778-11149800 ATGCTCCCCCAGAATGAAGAAGG + Intronic
1187448209 X:19375735-19375757 AGGGTGCTGCAGAGTGTAGAGGG + Intronic
1187933284 X:24313026-24313048 GTGATGCTCCAGAGAGAAGATGG - Intergenic
1187938943 X:24363028-24363050 GTGATGCTCCAGAGAGAAGATGG + Intergenic
1188267012 X:28089398-28089420 AAGATGATGCAGAGAGAAGATGG - Intergenic
1191705973 X:64094915-64094937 AATCTCCTCAAGAATGAAGATGG + Intergenic
1193241502 X:79175575-79175597 AACTTGGTCCACAGTGAAGATGG - Intergenic
1193363970 X:80608433-80608455 AAGCTGCTACTGACTGAAGTGGG - Intergenic
1195452574 X:105032486-105032508 AACCTGCTCCGGAATGAATACGG - Intronic
1195857213 X:109344313-109344335 GAGCTGCTCCAGTGGGCAGAAGG - Intergenic
1195952316 X:110287948-110287970 AAGCTCCTGAAGAGTGAGGATGG - Intronic
1195977763 X:110546185-110546207 AAACTGTTCCAGAGTAAAGAAGG - Intergenic
1196980081 X:121203173-121203195 AAGCTGTACCAGAGTGCAGGAGG - Intergenic
1197135467 X:123054833-123054855 CAGCTTCTTCAGAATGAAGAAGG - Intergenic
1197249890 X:124204588-124204610 AAGCTGTACCAGAGTGCAGGAGG - Intronic
1197667545 X:129240016-129240038 ACTCTTCTCCAGAGTGAAGCAGG - Intergenic
1198298421 X:135309659-135309681 AAGCAACTCCAGGGTGAACATGG + Intronic
1198307498 X:135397621-135397643 AAGCAACTCCAGGGTGAACATGG + Intergenic
1198499302 X:137226918-137226940 GAACTGCTGCAAAGTGAAGATGG + Intergenic
1199650206 X:149941799-149941821 AAGCTTCTCCAGGGAGAAGTAGG - Intergenic