ID: 972950136

View in Genome Browser
Species Human (GRCh38)
Location 4:44311398-44311420
Sequence ATCCAAATCAATCAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972950132_972950136 -7 Left 972950132 4:44311382-44311404 CCTGTTTACCCATTACATCCAAA 0: 1
1: 0
2: 1
3: 6
4: 155
Right 972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 158
972950131_972950136 13 Left 972950131 4:44311362-44311384 CCACAAATGTAGATAATTTTCCT 0: 1
1: 1
2: 4
3: 34
4: 466
Right 972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972950136 Original CRISPR ATCCAAATCAATCAGCTGGA AGG Intronic
902225059 1:14991577-14991599 ATCCAAAAGAAGCAGCTAGAAGG - Intronic
902567807 1:17324778-17324800 ATACACAAAAATCAGCTGGAGGG - Intronic
903110801 1:21131554-21131576 ATCAAAATCAAACAGCATGAAGG + Intronic
903641630 1:24863970-24863992 ATACAAAACAATTAGCTGGGCGG - Intergenic
904870166 1:33612419-33612441 ATCCAAAACCATGAACTGGAAGG - Intronic
907496680 1:54849991-54850013 ATCCAAAACCATCACATGGATGG + Exonic
908603473 1:65766552-65766574 ATCCAAATAAAGCAGATGAAAGG + Intergenic
910061327 1:83096301-83096323 ATCCAACTCAATGAATTGGAAGG - Intergenic
911395128 1:97296377-97296399 ATCTAAATAAATAAACTGGAAGG - Intronic
915497944 1:156294551-156294573 GTCAAACTCAAGCAGCTGGAGGG + Exonic
915731586 1:158058002-158058024 AGTGAAATCAATCAACTGGAAGG - Intronic
916083628 1:161252533-161252555 ATACAAAAAAATTAGCTGGATGG + Intergenic
916258527 1:162816191-162816213 ATCCAAAGCAAGCAGAAGGAAGG - Intergenic
921631857 1:217443068-217443090 ATCCAAATTAATCATCTACATGG + Intronic
921694142 1:218187582-218187604 AACCAAAGCATTCAGCTTGAAGG + Intergenic
921773941 1:219075167-219075189 AATCAAATCAATCATCAGGATGG - Intergenic
923731500 1:236555450-236555472 AGCCCAATCAAACAGCTGAAAGG + Exonic
924167923 1:241304562-241304584 AAGCAAATCACTCAGCAGGAGGG + Intronic
1062806453 10:423540-423562 ATAGAAATAAATCAGCTGCATGG - Intronic
1063943149 10:11151486-11151508 ATCCACCTCACTCAACTGGAAGG - Intronic
1066211719 10:33246531-33246553 AACCAAAACATTCATCTGGAAGG - Intronic
1069079009 10:64068166-64068188 GCCCAATTCAATCAGGTGGAAGG + Intergenic
1069079857 10:64077279-64077301 ATGCAAAACAGGCAGCTGGATGG + Intergenic
1070011304 10:72477210-72477232 ATTCAAATCAAACATCTTGAAGG + Exonic
1071906320 10:90178068-90178090 ATCCAAGTCAATCATGTGTAAGG - Intergenic
1072913745 10:99524403-99524425 ATGCAAATAAATCAGCTGCTGGG - Intergenic
1073921883 10:108468446-108468468 ATCCAAATGGATCAACTGAAAGG - Intergenic
1074837255 10:117308733-117308755 ATCCAAATCACCCAGCTAGCTGG - Intronic
1077913072 11:6590951-6590973 ATCCAAAGCAAGCAGAAGGAAGG - Intronic
1078563483 11:12393573-12393595 ATCCTCATCACTCAGCTGGTGGG + Intronic
1079337999 11:19588316-19588338 ATCCAAAACAATCTGGTGTATGG + Intronic
1080736134 11:35015789-35015811 TTCGAAATCCATCAGCTCGATGG - Intronic
1082684469 11:56220817-56220839 AGCCGATTCAATCAACTGGAAGG + Intergenic
1085849455 11:80103004-80103026 ATACAAAAAAATCAGCTGGGTGG - Intergenic
1089928385 11:122283146-122283168 CTCCAGTTCCATCAGCTGGAAGG - Intergenic
1090051346 11:123382543-123382565 ATGCAAATCAAGCAACTGCAAGG - Intergenic
1092926065 12:13273635-13273657 ATACAAATCAATCAATTGGGAGG + Intergenic
1093881733 12:24412309-24412331 ATCCAAAGCAAGCAGAAGGAAGG - Intergenic
1094124369 12:27007508-27007530 ATCCATTACAATCATCTGGAGGG + Intronic
1094301948 12:28974335-28974357 ATCCAAATGACTCATCTGCAAGG + Intergenic
1095912050 12:47437735-47437757 ATCCAAAGCAAACAGAAGGAAGG + Intergenic
1096445408 12:51686261-51686283 ATCTAAATCAATAACCTGAAAGG - Intronic
1096604605 12:52755535-52755557 AGCCAAATCATCCAACTGGAGGG + Intergenic
1098081068 12:66786218-66786240 ATCAAAATCATTCTGCTAGATGG + Intronic
1099662074 12:85576848-85576870 ATACAAAAAAATTAGCTGGATGG + Intergenic
1105433467 13:20358086-20358108 ACCCGAATCACTCTGCTGGATGG + Intergenic
1105818701 13:24060701-24060723 ATCCAAATCCAGCATCTGTAAGG + Intronic
1106887936 13:34210232-34210254 ATCCAGAGCAAGCAGCAGGAGGG + Intergenic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1108085231 13:46782381-46782403 ATCCAAATGAACCAGCTGCCAGG + Intronic
1112709676 13:102113251-102113273 ATCCAAATCAATCAGGAAGGTGG - Intronic
1113165699 13:107439299-107439321 ATACAAATCAATTTCCTGGAAGG + Intronic
1113183050 13:107654002-107654024 ACCCAAATCCATCAGAAGGAAGG + Intronic
1114295099 14:21321950-21321972 AACCGTATCAAGCAGCTGGAAGG + Exonic
1116052310 14:39819983-39820005 ATCCAAAGCAAGCAGAAGGAAGG - Intergenic
1118099982 14:62587092-62587114 ATTCAAAGCAAGCAGCAGGAAGG - Intergenic
1118268047 14:64314471-64314493 ATCCAAAGCAAGCAGAAGGAAGG + Intronic
1118566101 14:67142699-67142721 CTCCAAATTCATCAGCTTGAGGG + Intronic
1118713639 14:68543558-68543580 ATACAAATTAATGAGATGGAAGG + Intronic
1119109751 14:71960429-71960451 ATCCAGATGAATCTTCTGGAAGG + Intronic
1119724232 14:76912491-76912513 ACCCAAAAGAATCAGCAGGAAGG + Intergenic
1120916923 14:89718718-89718740 ATCCAACTCAATCAGCTTTATGG + Intergenic
1125258720 15:37797847-37797869 ATCCTAATCACACAGGTGGAAGG - Intergenic
1129492249 15:75939064-75939086 ATCCAAAGCTAGCAGATGGAAGG + Exonic
1130416375 15:83698328-83698350 AGTCAAATCCTTCAGCTGGATGG + Intronic
1133004921 16:2874677-2874699 ATCCAAAAAAATCAGCGGGACGG + Intergenic
1133106748 16:3516004-3516026 ATCTAAAGCAGTCAGTTGGAAGG + Intronic
1135515764 16:23132013-23132035 ATCCGAACCCAACAGCTGGAGGG + Intronic
1135718226 16:24791350-24791372 ATCCAAATAATTCATCAGGATGG + Exonic
1138347361 16:56328305-56328327 CTCCAACTCAACCAGCAGGAAGG - Intronic
1138371452 16:56530330-56530352 ATACAAAACAATTAGCTGGGTGG + Intergenic
1140751247 16:78026037-78026059 ATGCAAATTCATCAGCTGGTGGG - Intronic
1141799402 16:86296689-86296711 ATACAAATGAACCAGGTGGAAGG - Intergenic
1143554851 17:7653579-7653601 ATCAAAATCAAACTCCTGGAAGG - Intronic
1144232029 17:13217124-13217146 ATCAAGTTCAATCAACTGGATGG + Intergenic
1148193215 17:45694674-45694696 ACAAAAATCATTCAGCTGGAGGG - Intergenic
1150662065 17:67090900-67090922 ATTCAAATCAAGCAGAGGGAAGG - Intronic
1151222404 17:72622877-72622899 AACCACATCAGTCACCTGGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153607675 18:6851052-6851074 AACCACACTAATCAGCTGGATGG + Exonic
1155446493 18:25918272-25918294 ATCCTAAACAAACAGCTGGCAGG + Intergenic
1156881370 18:42084815-42084837 AGCCAAATCAATCTGCAGGTGGG + Exonic
1158295477 18:55992364-55992386 ATCCAAATCTAGCAGCAAGAAGG - Intergenic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
925459841 2:4051431-4051453 ATCCAAATTATTCTGCTGCATGG - Intergenic
925862758 2:8196247-8196269 ACCCAATTCAGGCAGCTGGAAGG - Intergenic
929303478 2:40332753-40332775 ATTAAAATGATTCAGCTGGATGG - Intronic
929586804 2:43121379-43121401 TTCCAATTCATTCAGTTGGAAGG + Intergenic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
932181475 2:69650325-69650347 ATCAATATCAATCTCCTGGAGGG - Intronic
938095768 2:128461899-128461921 ATCCAAATCCAGCAGAAGGAAGG + Intergenic
940906758 2:159176603-159176625 TTCCAATTCAAGCAGCTGAATGG - Intronic
941163924 2:162065149-162065171 ATCCAAACCAATCACCGGCAAGG - Intronic
943125414 2:183789976-183789998 AGCCGATTCAATCAACTGGAAGG + Intergenic
943901526 2:193444447-193444469 AACCAAATAAGTAAGCTGGATGG + Intergenic
945262532 2:207857850-207857872 ATCCAAAGCAAGCAGAAGGAAGG - Intronic
948038849 2:234883013-234883035 CTCCAAATCACTCAGCTAAAGGG - Intergenic
948947040 2:241225932-241225954 ATAAAAAGCAACCAGCTGGAAGG - Intergenic
1174119933 20:48257109-48257131 AACCAAATGCAACAGCTGGAAGG - Intergenic
1175533299 20:59689537-59689559 ATCCAAACCAATCAGATGGGAGG - Intronic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
950119164 3:10470491-10470513 ATCAAAGTCAACCAGCTGGGAGG - Intronic
950298207 3:11850265-11850287 ATGCAAAACCACCAGCTGGAAGG + Intergenic
951388751 3:22075898-22075920 ATCCAACTCAAGGAACTGGATGG - Intronic
952072920 3:29660861-29660883 CTGGAAATCATTCAGCTGGAGGG + Intronic
952349701 3:32522394-32522416 AGCCAAATCAACCTGGTGGAAGG + Intergenic
952356908 3:32593026-32593048 ATCCAAATCTCTCCTCTGGAGGG + Intergenic
957579376 3:82051137-82051159 ATCCAAACAAACCAGCTGGGAGG - Intergenic
958754741 3:98237516-98237538 ATGCATATCAATCACCTTGAGGG + Intergenic
970481022 4:16474688-16474710 ACCCAAATCATTCACCTGTAAGG - Intergenic
970499033 4:16658142-16658164 TTCCAATTCAATCAGTAGGATGG + Intronic
972696895 4:41455649-41455671 ACCCAAATAAAACAGCTGTATGG + Intronic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
974388842 4:61238015-61238037 TTCAAAATCAATCAGCTGAAAGG - Intronic
974446368 4:61988059-61988081 ATCAAAATCCATCAGCCAGATGG - Intronic
975794635 4:77994321-77994343 ATCCAAATCCAGCAGCCAGAGGG + Intergenic
975915021 4:79314416-79314438 GTGCAAAACAATCACCTGGAGGG + Intronic
976357779 4:84139348-84139370 ATCCAAAGCAAGCAGAAGGAAGG + Intergenic
979461473 4:120989463-120989485 AGCCAAATCAATCAAGTAGAAGG - Intergenic
979599651 4:122573959-122573981 AGCCGATTCAATCAACTGGAAGG - Intergenic
988285405 5:29209493-29209515 ACCTAAATAAATCAACTGGAAGG + Intergenic
989618903 5:43365936-43365958 AGCCAAATCAATCAAGTGGAAGG - Intergenic
990850967 5:60204533-60204555 TTCAAAATCAATGGGCTGGATGG + Intronic
992214906 5:74516396-74516418 TTACAAATCCCTCAGCTGGATGG - Intergenic
994648169 5:102495737-102495759 ATCTAAATAAATCAGAAGGAAGG + Intronic
996340194 5:122429302-122429324 ATCCAAAGCAAGCAGAAGGAAGG + Intronic
996779797 5:127172732-127172754 GTCAAAATCAATCAGCTGTCGGG - Intergenic
997958530 5:138299750-138299772 ATCCAAAGCAAGCAGAAGGAAGG + Intronic
999008271 5:148006064-148006086 ATCCAAATGAAACAAGTGGAGGG - Intergenic
1001902407 5:175443274-175443296 ATCCAAGTCAATCCCGTGGATGG + Exonic
1003733013 6:8847035-8847057 TTCTGAATCAACCAGCTGGAAGG + Intergenic
1004714646 6:18205581-18205603 ATCCAATTCAGTGAGCTGGAGGG + Intronic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1009374761 6:62953503-62953525 TTCCAAGTAAATCATCTGGAAGG - Intergenic
1013534306 6:111049696-111049718 ACCCAAAGCAAGCAGCAGGAAGG - Intergenic
1015113733 6:129622163-129622185 ATCAAACTCAATGAGGTGGAGGG + Intronic
1019961519 7:4464366-4464388 ATCCAAATCATAGAGGTGGAAGG - Intergenic
1020790576 7:12623326-12623348 TACCAAATGAAACAGCTGGAGGG + Intronic
1021640564 7:22732663-22732685 ATCTAAGTCACCCAGCTGGAAGG + Intergenic
1021807745 7:24373874-24373896 ATACAAATCACTGAGCTAGAGGG - Intergenic
1024211102 7:47205597-47205619 ATCCAAAACAAGCAGAAGGAAGG + Intergenic
1031448281 7:121881772-121881794 ATTCAAGTCTATCAGCTGGTAGG + Intronic
1033003957 7:137539718-137539740 ACCCAAATCAAGCAGAAGGAAGG + Intronic
1035533148 8:371342-371364 AGCCGATTCAATCAACTGGAAGG - Intergenic
1036118715 8:5990273-5990295 ATCCAAGCCTTTCAGCTGGAGGG + Intergenic
1037054966 8:14428679-14428701 TTCCAAATAAATCAGTTGGTTGG - Intronic
1045208306 8:100067117-100067139 ATCCAACTCAGTCAGCTGGTTGG + Intronic
1045724626 8:105158119-105158141 ATGCAAAACAATCAGCTGAAGGG + Intronic
1045912158 8:107423412-107423434 TTCCACATCAGACAGCTGGATGG + Intronic
1048311683 8:133327460-133327482 ATACAAAAAAATTAGCTGGATGG + Intergenic
1050899507 9:10928679-10928701 ATGGAAATCAATGAGCTGAAAGG + Intergenic
1052032829 9:23647542-23647564 AAAAAAATCAATCAGCTGGGGGG + Intergenic
1053379564 9:37637133-37637155 ATCCAAACCATCGAGCTGGATGG - Intronic
1055914596 9:81388053-81388075 CTTCAAATGAATCACCTGGATGG + Intergenic
1057835271 9:98439704-98439726 ATCCAACTGAAGCAGCTGGTTGG + Intronic
1058213477 9:102202488-102202510 ATCCAAATCAATCCACTTGGGGG - Intergenic
1058316798 9:103578468-103578490 GTCCAGATCAATGACCTGGAGGG - Intergenic
1062182478 9:135198070-135198092 AGCCAAATCAAACTTCTGGAAGG + Intergenic
1186456826 X:9716212-9716234 ATCCAAAACACACACCTGGAAGG - Exonic
1188893142 X:35635145-35635167 AGCCTAATCAATCAAGTGGAAGG - Intergenic
1190494635 X:51017430-51017452 AGCCAATTCAATCAACTGGAAGG - Intergenic
1191004713 X:55698769-55698791 ACCCAAATCAATCTCCTGGAAGG - Intergenic
1193594951 X:83434773-83434795 AGCCAAATCGATCAAGTGGAAGG - Intergenic
1194538313 X:95136338-95136360 ATCAAAATCAATCAGCATGGAGG + Intergenic
1195069889 X:101268716-101268738 ATGCAAACCAAACAGCTGTACGG + Exonic
1196190075 X:112784922-112784944 GTCCATATCAATTAGCTGGCAGG - Intronic
1198084644 X:133270618-133270640 ATCCTACTCAAACAGCTAGAGGG + Intergenic
1200910507 Y:8527546-8527568 ATCCAAAAGAATCAGAAGGATGG + Intergenic
1202384364 Y:24310642-24310664 GTCCAGATCAAGAAGCTGGAAGG + Intergenic
1202486419 Y:25359480-25359502 GTCCAGATCAAGAAGCTGGAAGG - Intergenic