ID: 972956219

View in Genome Browser
Species Human (GRCh38)
Location 4:44395489-44395511
Sequence GGGTGTTCCCAGAATCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972956219_972956224 0 Left 972956219 4:44395489-44395511 CCATGAGGATTCTGGGAACACCC 0: 1
1: 0
2: 2
3: 15
4: 171
Right 972956224 4:44395512-44395534 ATATTCGGCATAAAAATGGATGG 0: 1
1: 0
2: 2
3: 29
4: 287
972956219_972956221 -4 Left 972956219 4:44395489-44395511 CCATGAGGATTCTGGGAACACCC 0: 1
1: 0
2: 2
3: 15
4: 171
Right 972956221 4:44395508-44395530 ACCCATATTCGGCATAAAAATGG 0: 1
1: 1
2: 2
3: 33
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972956219 Original CRISPR GGGTGTTCCCAGAATCCTCA TGG (reversed) Intronic
904714431 1:32456662-32456684 GGGTGGGCCCAGAAGCCACAGGG + Intergenic
905468154 1:38171404-38171426 GGGAATTCCCAGAAACTTCAAGG - Intergenic
910610151 1:89132936-89132958 GGTTGTGCCAAGAATCCTAAGGG + Intronic
912868435 1:113280653-113280675 CTGTGTTCCCAGAGTCCTCGAGG - Intergenic
913692707 1:121294346-121294368 GGGTCTTCCCACAATTCACAGGG - Intronic
914144849 1:144985744-144985766 GGGTCTTCCCACAATTCACAGGG + Intronic
914504853 1:148280414-148280436 GAGGGTTCCCAGAATCCTAGCGG + Intergenic
914507707 1:148303727-148303749 GAGAGTTCCCAGAATCCTAGTGG - Intergenic
915942183 1:160125382-160125404 GGGTGTTTCCATAATATTCAGGG - Intronic
919895897 1:202009800-202009822 CGGAGTTGCCAGAATCCACACGG - Exonic
920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG + Intronic
920301038 1:204989195-204989217 GGTTGTCCCCAGAGCCCTCATGG - Intronic
920480028 1:206312707-206312729 GGGTCTTCCCACAATTCACAGGG - Intronic
922250807 1:223846740-223846762 GGGTGTTCCCAGCACCCCCCAGG - Intergenic
922956064 1:229601621-229601643 GGGTGTTCCCAGACCCCACTTGG - Intronic
923706974 1:236351952-236351974 GGATGTTCCCAGAACTGTCATGG + Intronic
1064864824 10:19867558-19867580 GGTTGCTCCCTGACTCCTCAAGG + Intronic
1066501502 10:35999595-35999617 GTGTGTTCACAGACTCCTAAGGG - Intergenic
1066629368 10:37443920-37443942 GTGTGTTCACAGACTCCTGAGGG - Intergenic
1067180655 10:43983473-43983495 TGGTGTTCCTGGAATCCCCAGGG - Intergenic
1068612978 10:59080812-59080834 GGGTTTTCCCATAATGCTTAAGG - Intergenic
1069866530 10:71507065-71507087 TGGTCTTCCCAGAATCCTCTTGG + Intronic
1069906168 10:71733852-71733874 TTGTGTTCCCAGTATCCTCTAGG - Intronic
1070749203 10:78954039-78954061 GCGTGCTTCCATAATCCTCAAGG + Intergenic
1072215858 10:93286579-93286601 GAGTGATCCCAGAATCTGCAAGG + Intergenic
1072295368 10:94004245-94004267 CTGTGTGTCCAGAATCCTCAAGG - Intronic
1074489628 10:113927592-113927614 GGATTTTCCCAGAAATCTCAGGG + Intergenic
1076494499 10:130888101-130888123 GGGTTTTCCCAGACTCTCCATGG + Intergenic
1077420651 11:2448361-2448383 GGGTGTTGGCAGAACCCTCGCGG + Intronic
1078005136 11:7526942-7526964 GTGTGTTCTCAAAATCTTCAAGG - Intronic
1081658451 11:44873398-44873420 GGGTTGTCACAGAATCCCCAGGG - Intronic
1083173288 11:60935163-60935185 GGGTGCTCCCAGCACCCTCACGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084897331 11:72282956-72282978 GCATCTTCCCAGAATCCTCTGGG + Intergenic
1085526720 11:77168189-77168211 GAGTGTTCCCAGATGCCTCAAGG - Intronic
1088163732 11:106906518-106906540 GGGTGTTCACCCATTCCTCAAGG + Intronic
1090227740 11:125081780-125081802 GACTGTTCCCAGGGTCCTCAGGG - Exonic
1090376599 11:126293930-126293952 GGGAGTCCCCAGCTTCCTCATGG - Intronic
1091035378 11:132228247-132228269 GGATGTTCACAGAATTCCCAGGG - Intronic
1092236275 12:6812028-6812050 GGTTGGTCCCAGACTCCTGACGG + Intronic
1092768722 12:11877529-11877551 GGATGTCCCCAGAAGCCACAGGG + Intronic
1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG + Intergenic
1096818205 12:54215032-54215054 GCCTGTACCCAGAATCCTCCAGG + Intergenic
1100363650 12:93899786-93899808 GGGTGTTCCTGGAAACATCATGG - Intergenic
1100436404 12:94575264-94575286 GGGAGTAGCCACAATCCTCAGGG - Intronic
1100999143 12:100338793-100338815 AGGTGTTCCCAGAGTCATCTTGG - Exonic
1102613836 12:114135610-114135632 AGGGGTTCCCAGAATCCCCGTGG + Intergenic
1104756119 12:131270355-131270377 TGGGGTGCCCAGACTCCTCAGGG - Intergenic
1104777657 12:131400670-131400692 TGGGGTGCCCAGACTCCTCAGGG + Intergenic
1116394755 14:44434211-44434233 TGGTGTTCTCAGTCTCCTCAGGG + Intergenic
1117406861 14:55412124-55412146 CCGTTTTCCCAGAATCCTTAGGG - Intergenic
1121932732 14:97987827-97987849 GTGTGTACCTAGAATCCTCTGGG - Intergenic
1122784438 14:104157341-104157363 GGGTGCTCCCAGGAGGCTCAGGG + Intronic
1123479733 15:20620026-20620048 TGGTGCTCCCTGAATCCACATGG + Intergenic
1123638273 15:22380338-22380360 TGGTGCTCCCTGAATCCACATGG - Intergenic
1123788632 15:23697209-23697231 GGGGGTCCTCAGAATCCTCCTGG + Intergenic
1125257586 15:37783338-37783360 TGGAGTTCCCAGAACCCTCCAGG - Intergenic
1128972204 15:72117811-72117833 GGGTGGGCCCAGCAGCCTCAGGG + Exonic
1130737973 15:86570547-86570569 GGGTGTTCCCCGAACTGTCATGG + Intronic
1130766901 15:86879856-86879878 GGATGTTGCCAGAATACCCATGG + Intronic
1133682227 16:8130383-8130405 GTGTGTTCCCGGAATTGTCATGG - Intergenic
1134686907 16:16165491-16165513 GGCTGTTCCTAGAATTCCCAGGG - Intronic
1137582997 16:49645606-49645628 TGGTGTTCCCAAAATCCTGTTGG + Intronic
1138658319 16:58503233-58503255 GTGTGAGCCCAGCATCCTCAAGG - Intronic
1140274660 16:73497701-73497723 TGGTGTTCCCAGGATTCCCAGGG - Intergenic
1142073248 16:88102943-88102965 GGGTGTTCAAAGACTCTTCAAGG + Intronic
1142362028 16:89631906-89631928 GGGTGGTCCCTGCATCCTCATGG + Intronic
1142979969 17:3666001-3666023 GGGTGTTCCCACCATGCTCTGGG + Intronic
1144596449 17:16574146-16574168 GGGAGTCCCCAGAAGCTTCAAGG + Intergenic
1146289612 17:31598178-31598200 AGGTGCTCCCAGCTTCCTCAGGG - Intergenic
1147212630 17:38880718-38880740 GGTTCATCCCAGAATCCCCACGG - Intronic
1151866059 17:76803744-76803766 CTGTGATCCCAGAATGCTCAGGG + Intergenic
1153226896 18:2906661-2906683 GGGTGGCCGCAGAGTCCTCACGG + Intronic
1154104241 18:11506388-11506410 GAGTGTTTCCAGAATCCTTAGGG + Intergenic
1160934599 19:1587874-1587896 CCGTTTTCCCAGAATCCTCTAGG + Intronic
1164384425 19:27760994-27761016 GGGTGATCCCAGCATTCTAATGG - Intergenic
1164865365 19:31600113-31600135 GGGTGTTCCCACAGTGCTGATGG - Intergenic
1165143745 19:33718710-33718732 GTGTTTACCCAGAATCCTCCTGG + Intronic
1165829576 19:38723830-38723852 GGATGTTCTCTGACTCCTCAGGG + Intronic
1166060588 19:40323140-40323162 GAGTGTTCCCATCCTCCTCATGG + Intronic
1166818929 19:45564436-45564458 GGCTGTTCTCAGAGTCCTCCTGG - Intronic
926790431 2:16565693-16565715 GGATGCTCTCAGAATCCTGAAGG + Exonic
927110257 2:19859378-19859400 GGGCATTTCCAGAATCCCCAAGG + Intergenic
927158475 2:20236141-20236163 TGGTGTTCCCTAAATGCTCAGGG + Intergenic
932150864 2:69370526-69370548 GTGTTTTCCCAGTATCTTCAGGG - Intronic
935413333 2:102788479-102788501 AGCTGTCACCAGAATCCTCAAGG - Intronic
937788466 2:125930705-125930727 GAGTGTTCCCAATATCCTTAAGG - Intergenic
938061701 2:128260264-128260286 GGGTGGTTCCACAATCATCAAGG + Intronic
941598682 2:167511259-167511281 TGTAGTTCCCATAATCCTCATGG + Intergenic
948014302 2:234675371-234675393 GGGTGTTCTCAGAACCATCATGG + Intergenic
1169782347 20:9323147-9323169 GAGTGTGCCTAGAATGCTCAGGG - Intronic
1172050468 20:32113310-32113332 GGGTGTTTCCTGAACCCGCAGGG + Intronic
1172093231 20:32448005-32448027 GGGTTCTCAGAGAATCCTCAGGG + Intronic
1172168924 20:32917204-32917226 GTCGGCTCCCAGAATCCTCAAGG + Intronic
1173718741 20:45235160-45235182 TGGTGTCCCCAGAATCCTGTAGG + Intergenic
1173916738 20:46713651-46713673 AGGTTTTCCCAGAATCCTTCTGG + Intronic
1174102405 20:48137647-48137669 GGGTGTTCCCAGCATCTGCCTGG + Intergenic
1174385994 20:50189111-50189133 GGGTCTTCCCAGCAGCCTCTGGG - Intergenic
1175609640 20:60339977-60339999 GTGTGTTCCCAGAATTGTCCTGG + Intergenic
1176123779 20:63466097-63466119 GCGTGTTCCCAGCATCCTGAGGG - Intronic
1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG + Intergenic
1179382509 21:40912283-40912305 GGATGTTCACAGCATCCCCAGGG - Intergenic
1179545381 21:42109714-42109736 GGGTCTTCCCAGAGTCGGCAGGG - Intronic
1179626249 21:42651119-42651141 GGGTTTTCACAGGATCCTCTTGG - Intergenic
1180004490 21:45013884-45013906 GGGTGTTCCCAGAACTGTCCTGG + Intergenic
1180026907 21:45169917-45169939 GGGTGCTCCCAGGAGCCTCCTGG - Intronic
1182300094 22:29332288-29332310 GGGTGGTCCCAGAGTTTTCAAGG - Intronic
1183284700 22:36954529-36954551 GCTCGTTCCCAGCATCCTCAAGG - Intergenic
1183736054 22:39645577-39645599 GGATTTTCCCAGAGTCCTCTGGG + Intronic
1185363462 22:50423231-50423253 GAGTGCTCCCAGGATGCTCACGG - Intronic
954413845 3:50383300-50383322 GGGAATTCCCAGGGTCCTCAGGG - Intronic
955163431 3:56487449-56487471 GGGAGTGCACAGGATCCTCATGG - Intergenic
956412702 3:68995145-68995167 TGGTGTTGCCAGAGTCCTGATGG - Intronic
956447388 3:69338966-69338988 TAGTTCTCCCAGAATCCTCATGG + Intronic
957873314 3:86114327-86114349 GGTTGTGACTAGAATCCTCAGGG - Intergenic
968530778 4:1090285-1090307 GGGTGTACACAGAATGTTCATGG + Intronic
969313520 4:6368079-6368101 GGATGTTCCCAGGATCCACAGGG + Intronic
969600294 4:8172079-8172101 GGATGAGCTCAGAATCCTCAGGG - Intergenic
970900540 4:21153691-21153713 GGGTTTTCCCAGAATTCCAAAGG - Intronic
971477726 4:27088056-27088078 GGCTTTTCCCAGTATTCTCATGG + Intergenic
972183528 4:36499457-36499479 GGGCATTCCCAGTATCATCACGG - Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
977893692 4:102341496-102341518 GGGAGTTCCTAGAATACACAGGG - Intronic
978920542 4:114177830-114177852 GGGTGTGGCCATAATCCCCAGGG + Intergenic
980560225 4:134462564-134462586 TGCTGTTCTCAGAATCCTGATGG - Intergenic
982055074 4:151540800-151540822 GGTTATTCCCAGACTTCTCAGGG + Intronic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
983188270 4:164725862-164725884 GGGTGTTCAAAGACACCTCAGGG + Intergenic
985613567 5:905395-905417 AGGAGTGCCCAGGATCCTCATGG - Intronic
986301946 5:6484331-6484353 GGAGGGGCCCAGAATCCTCAGGG - Intronic
987944036 5:24581129-24581151 GGGGGTGCCCAGAATCCCTAGGG - Intronic
989113587 5:37930249-37930271 GTGGGTTCCCAGAAGCCACAGGG + Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
991767227 5:69998367-69998389 GGGCATTCCCAGAAACATCAAGG + Intergenic
991846461 5:70873445-70873467 GGGCATTCCCAGAAACATCAAGG + Intergenic
993161528 5:84297976-84297998 TGGTGTTCCCAAAGCCCTCAAGG + Intronic
994179054 5:96743845-96743867 GGGTGTTGGCAGAATCCTGGGGG + Intronic
995130286 5:108622934-108622956 GAGTGTTCCCAGAACTGTCATGG + Intergenic
996639116 5:125730839-125730861 TGGGCTTCCCAGATTCCTCAGGG - Intergenic
996873226 5:128215278-128215300 GTGGGTCCCCAGAACCCTCAAGG + Intergenic
997422120 5:133778079-133778101 GGGGTTTCCCAGCATCCTCGAGG + Intergenic
998415046 5:141940163-141940185 GGCTCTTCCCATAATACTCAAGG - Exonic
1004294381 6:14397068-14397090 GGGTGGTCCCAGAATCCTTGGGG - Intergenic
1004583694 6:16979061-16979083 GGGTCTTCCCAGTATCTGCAAGG + Intergenic
1007080179 6:39094996-39095018 CATTTTTCCCAGAATCCTCATGG - Intergenic
1009250159 6:61288854-61288876 GGGTGTCCTCAGGATCCTCCTGG + Intergenic
1009967224 6:70590445-70590467 AGGTGTTCCCAGAATAGTCATGG + Intergenic
1013160448 6:107538731-107538753 GGGTGTTCTCAGAAAGCTCTGGG + Intronic
1013367201 6:109445384-109445406 GGGGGTTCCCAAAATTCTGATGG - Intronic
1013634556 6:112016672-112016694 GTATGTTCCCACAATGCTCATGG + Intergenic
1018783947 6:167093585-167093607 AGCTGTTTCCAGAATCCTCTGGG + Intergenic
1022805154 7:33814127-33814149 GCGTGTTCCCAGTGTTCTCATGG + Intergenic
1027343958 7:77238239-77238261 GTGTGTTCTCAGAGTTCTCAAGG + Intronic
1033681990 7:143603831-143603853 TGGTTTTCCCATAATTCTCACGG - Intergenic
1033702900 7:143858082-143858104 TGGTTTTCCCATAATTCTCACGG + Intronic
1035234750 7:157489051-157489073 CGGTGTTCTCAGAACCCTCCTGG - Intergenic
1035457124 7:159015895-159015917 GGCTGTCCCCAGACACCTCAAGG + Intergenic
1036454431 8:8894320-8894342 GGGTGTCCCCGGAATTGTCATGG - Intergenic
1036691045 8:10944960-10944982 CTCTGTTCCCAGAAGCCTCAGGG - Intronic
1036753794 8:11459401-11459423 CAGTGTTCCTAGAAACCTCAGGG + Intronic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1040310078 8:46232309-46232331 GGAGGTTCCCAGCATCCGCAAGG - Intergenic
1044300760 8:90580498-90580520 GGGTGTTTCCAGAACTGTCATGG - Intergenic
1045203453 8:100011398-100011420 TGGTCTTCCCAGACTCCTCTTGG + Intronic
1046713553 8:117542098-117542120 GGGTGGACACAGAATCCTGAGGG - Intergenic
1046715059 8:117558264-117558286 AGGAGCCCCCAGAATCCTCAGGG - Intergenic
1047204069 8:122789394-122789416 GGGTGTACCCAGAACCCCCCAGG + Intronic
1047563294 8:126012495-126012517 GGGGGTTCTCAGGATCCTCCCGG - Intergenic
1048672173 8:136735311-136735333 TGCTGTTCACATAATCCTCAGGG + Intergenic
1050148926 9:2599679-2599701 CTGTGTTACCAGAAGCCTCATGG - Intergenic
1050723045 9:8612730-8612752 GGGTGGTCCCACCAGCCTCAGGG - Intronic
1053537275 9:38938117-38938139 AGGGGCTCCCAGATTCCTCATGG - Intergenic
1054628860 9:67425813-67425835 AGGGGCTCCCAGATTCCTCATGG + Intergenic
1055931671 9:81565670-81565692 GGGTGTTCCCAGTGATCTCAAGG + Intergenic
1059325914 9:113503944-113503966 GTGTTTTCCCAGAATTCTTATGG + Intronic
1060856145 9:126915572-126915594 GGATGCCCCCAGAATCCTCAGGG - Intronic
1061214953 9:129216383-129216405 GGGTCTGCCCAGCATCCGCAGGG - Intergenic
1061512484 9:131069553-131069575 GGGTGTTCCCAGAATGCCCTAGG - Intronic
1062040847 9:134403616-134403638 TGGTGCTCCCAGAATCCTCAGGG + Intronic
1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG + Intergenic
1186548592 X:10478044-10478066 GGAGGTTCTCAGACTCCTCAAGG - Intronic
1187615651 X:20991000-20991022 TGTAGTTCCCATAATCCTCATGG - Intergenic
1190031216 X:46974747-46974769 GGGTATTCCCTGAAACCTAAAGG - Intronic
1190707783 X:53044952-53044974 GGGTTTTCCCAGAAGAGTCATGG - Intergenic
1193722746 X:85005494-85005516 GAGTGTGCCCAGAGTCCTCTGGG - Intronic
1194363329 X:92982454-92982476 GCATGTGCCCAGAGTCCTCAAGG + Intergenic
1198256658 X:134929998-134930020 GGGTGTTCCCAGAACTGTTATGG + Intergenic
1199615112 X:149649922-149649944 GGTTCTCCCCAGAGTCCTCAGGG - Intergenic