ID: 972958563

View in Genome Browser
Species Human (GRCh38)
Location 4:44422879-44422901
Sequence CAGCCACCTCTACCATCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972958563_972958566 11 Left 972958563 4:44422879-44422901 CCTCAGGATGGTAGAGGTGGCTG 0: 1
1: 0
2: 2
3: 24
4: 222
Right 972958566 4:44422913-44422935 GTTACTGATGTTGTTGTTGGTGG 0: 1
1: 0
2: 5
3: 83
4: 770
972958563_972958565 8 Left 972958563 4:44422879-44422901 CCTCAGGATGGTAGAGGTGGCTG 0: 1
1: 0
2: 2
3: 24
4: 222
Right 972958565 4:44422910-44422932 GCTGTTACTGATGTTGTTGTTGG 0: 1
1: 0
2: 4
3: 22
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972958563 Original CRISPR CAGCCACCTCTACCATCCTG AGG (reversed) Intronic
900411401 1:2514307-2514329 TGGCCACCTCTTCCATCCAGAGG - Intronic
901244412 1:7717983-7718005 CAGTCACCGCTACATTCCTGAGG - Intronic
903084481 1:20843229-20843251 GAGCCACCGCTTCCAGCCTGAGG - Intronic
903265668 1:22156557-22156579 CAGCCACCTCTAACTTCAAGGGG - Intergenic
903671023 1:25035265-25035287 CTGCCAGCTCTGCCATCCTGAGG - Intergenic
908606454 1:65802356-65802378 TGGCCACCTCTACCTGCCTGTGG - Intronic
908718845 1:67100948-67100970 CCGCCACCACCACCACCCTGGGG - Intronic
908922839 1:69216933-69216955 CAGCCCTCAGTACCATCCTGGGG + Intergenic
910690432 1:89959901-89959923 CACACACCCCTACAATCCTGAGG + Intergenic
912159146 1:106959860-106959882 CTTCCACCTATATCATCCTGTGG + Intergenic
914028520 1:143934856-143934878 CAGCTCCCTCTACCAAACTGAGG + Intergenic
915076309 1:153310785-153310807 CTGCCTCCCCTACCATCCTGTGG + Intergenic
915080381 1:153348060-153348082 CTGCCTCCTCTACCATCCTGTGG + Intronic
915797481 1:158752233-158752255 CAGGCACCTCTGCGCTCCTGGGG - Intergenic
916174123 1:162023724-162023746 CAGCCACCTGAGCCCTCCTGCGG - Exonic
917672556 1:177286805-177286827 CAGCCAGCTCTGTCATCGTGAGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919481863 1:198099898-198099920 AAGCCACCTGTGCCATCATGGGG - Intergenic
920463986 1:206165747-206165769 CAGCTCCCTCTACCAAACTGAGG + Intergenic
921175454 1:212589603-212589625 CTGCCACCTCCACCTTCCTGGGG - Intronic
923775904 1:236978255-236978277 GAGCCACCGCTCCCAGCCTGTGG - Intergenic
1064271143 10:13867334-13867356 CTGCAACCTCTGCCTTCCTGGGG + Intronic
1064326212 10:14353903-14353925 CAGCCATCTCCACTCTCCTGGGG + Intronic
1065040077 10:21684430-21684452 CAGCCACCTCAACCAGACTTAGG + Intronic
1065296750 10:24283115-24283137 GAGCCACCGCAACCAGCCTGAGG + Intronic
1068030341 10:51698312-51698334 CTACCACCTCTACCATCCATAGG + Exonic
1068121346 10:52784916-52784938 CAGCCAGAGCTACCTTCCTGTGG - Intergenic
1069514675 10:69068246-69068268 CTGCCAGCTCTCCCTTCCTGGGG + Intergenic
1069912233 10:71766574-71766596 CTGCCAGCTCTAAAATCCTGTGG + Intronic
1072269007 10:93757238-93757260 CGGCCAGCTCTAGCTTCCTGGGG - Intergenic
1075826745 10:125363499-125363521 CCTCCACCTCAACCATCCTATGG - Intergenic
1076283133 10:129267385-129267407 CAGCCCCCTCTTCCCTCCAGGGG - Intergenic
1076352032 10:129823474-129823496 GAGCCACCACGCCCATCCTGTGG + Intergenic
1077089478 11:771940-771962 CAGCCACCTCTCCCTGCCTCAGG + Intronic
1077245852 11:1537654-1537676 GAGCCACCACGACCAGCCTGGGG - Intergenic
1077998845 11:7476618-7476640 CAGGCAGCTGTCCCATCCTGGGG + Intergenic
1078559835 11:12361839-12361861 CTGCCACCTCTGCCCTGCTGAGG - Intergenic
1081467290 11:43332877-43332899 CAGTCAGCTCCCCCATCCTGTGG + Intronic
1082820514 11:57541619-57541641 TTGCCAGCTCTACCAGCCTGTGG - Intergenic
1084164588 11:67369550-67369572 CAGTCACCTCTAGGATCCTATGG + Intronic
1085241308 11:75058619-75058641 CATTCACCACCACCATCCTGAGG - Intergenic
1086557449 11:88127777-88127799 CAGCCAACCCTACCTTGCTGGGG - Intronic
1088685901 11:112284452-112284474 CAGCCAGCCCTCCAATCCTGGGG - Intergenic
1089696850 11:120221186-120221208 CAGCCTCCTCCACCATCCCCTGG + Intronic
1089747876 11:120629740-120629762 CAGCCACCTTTTCCTTCCAGCGG + Intronic
1090596374 11:128324953-128324975 TAGCAGCCTCTACCATTCTGTGG - Intergenic
1090878577 11:130813517-130813539 GAGCCGCTTATACCATCCTGCGG + Intergenic
1091201534 11:133784443-133784465 CAGCCATCTCCTCCAGCCTGGGG + Intergenic
1096629075 12:52913934-52913956 GAGCCACCTCTCTCAGCCTGAGG - Intronic
1099202190 12:79690302-79690324 CTGCCTCCTCTTCCTTCCTGCGG + Exonic
1100468632 12:94871947-94871969 CATCCACCTCTTTCATCCTAAGG + Intergenic
1102578030 12:113869348-113869370 CAGGCACCTCTGCCATCCCTTGG + Intronic
1103853490 12:123948285-123948307 CAGCCATCTCTATCATAGTGTGG + Intronic
1104013764 12:124949348-124949370 CAGACACCTCCCCCTTCCTGGGG - Intronic
1104398757 12:128458560-128458582 CAGGCACCTTTCCCATCATGGGG + Intronic
1104796613 12:131524375-131524397 CAGCCCCCTCTGCCATCATGCGG - Intergenic
1104796626 12:131524418-131524440 CACCCCCCTCTGCCATCATGCGG - Intergenic
1105295652 13:19086255-19086277 CAGCCACCTCTGCAGCCCTGGGG + Intergenic
1106187372 13:27421250-27421272 CAGACAACTCTCCCACCCTGAGG + Intergenic
1110182977 13:72639197-72639219 CAGCCCCCTCCACTATCCTGCGG + Intergenic
1112730158 13:102351741-102351763 CAGCCAGCTGTCACATCCTGAGG - Intronic
1115152646 14:30302978-30303000 CAGCCACCTCTGGGATGCTGAGG - Intergenic
1121507773 14:94489751-94489773 CAGACACGTCTACGACCCTGGGG + Exonic
1122577157 14:102749773-102749795 CAGCCACCACTGCCATCCTAGGG + Intergenic
1122686478 14:103510383-103510405 CAGCCACCTATCTCATCCTTGGG - Intergenic
1122807282 14:104266266-104266288 CTGCCCCCTCTCCCACCCTGAGG + Intergenic
1122961313 14:105094718-105094740 CAGCCTCATCTTCCATGCTGAGG - Intergenic
1123830867 15:24135993-24136015 CTCCCACCTCTGCCATCATGGGG + Intergenic
1123835945 15:24193366-24193388 CTCCCACCTCTGCCATCATGGGG + Intergenic
1124668517 15:31616033-31616055 CATTCATGTCTACCATCCTGAGG - Intronic
1125274974 15:37979818-37979840 CAGCCATCTCACCCCTCCTGGGG - Intergenic
1125397007 15:39260013-39260035 CAGCCACATATAAGATCCTGGGG + Intergenic
1125854538 15:42936360-42936382 GAGCCACCTCGCCCAGCCTGTGG + Intergenic
1127404560 15:58628641-58628663 CAGCAGCCCCTACCATCCTGGGG + Intronic
1128072143 15:64804418-64804440 CAGCAGCTCCTACCATCCTGTGG - Intergenic
1129290483 15:74563185-74563207 CGGCCACCTCTACCAGGCTGAGG - Intronic
1130286677 15:82561153-82561175 CAGCCACCTCTACCATACTCTGG - Intronic
1131050725 15:89346195-89346217 CAGCCACATCTACCGCCATGTGG - Intergenic
1132457230 16:30891-30913 CAGTCACATCTACCACCTTGGGG + Intergenic
1132720400 16:1312797-1312819 GAGCCACCTCTACAAAGCTGGGG - Intronic
1133908237 16:10040925-10040947 AAGCCACCTCTTCCAGCCTGCGG - Intronic
1135950070 16:26905937-26905959 GAGCCACCTCTACTGGCCTGGGG - Intergenic
1138613204 16:58144024-58144046 CAGCCACATCTAACTGCCTGGGG - Intergenic
1139469345 16:67170052-67170074 CAAGCACCTCCACCCTCCTGGGG - Intergenic
1140099158 16:71899589-71899611 GAGCCACCACTCCCAGCCTGAGG - Intronic
1141004231 16:80337212-80337234 CTGTCAACTCTACCATCCTGTGG - Intergenic
1141652629 16:85401635-85401657 CAGCCACTTGTCCCAGCCTGGGG - Intergenic
1142282084 16:89153959-89153981 CAGGCGCCTCGGCCATCCTGAGG - Intronic
1143371320 17:6441947-6441969 AAGCCACCAGTACCATCATGGGG + Intergenic
1143416678 17:6755828-6755850 CAGCCGCATCTACCTCCCTGAGG - Exonic
1144234000 17:13239016-13239038 CACCCACCTTTGCCATTCTGAGG - Intergenic
1145013544 17:19382936-19382958 CAGCCACCTTACCCATCCTGTGG - Exonic
1146707690 17:35013488-35013510 AAGTCACCTCTACCATCTGGGGG + Intronic
1147310271 17:39592016-39592038 CAGCCCCTTTTTCCATCCTGTGG - Intergenic
1147319788 17:39639190-39639212 AAGCCACTTCAACCATCCTCAGG - Intronic
1148126538 17:45240381-45240403 CTGCCACCACTGCCATCCAGAGG - Intronic
1149381910 17:56103062-56103084 CTGCTACCTCTATGATCCTGGGG + Intergenic
1150624873 17:66835274-66835296 AGACCACCTCTTCCATCCTGGGG + Intronic
1151522592 17:74641069-74641091 CAGCCACATCTTCCTTGCTGGGG + Intergenic
1151888048 17:76934823-76934845 CAGCCACCTCTGACTTCCTTTGG - Intronic
1154198814 18:12285249-12285271 AAGCCACCTCTAAGATCCTGGGG + Intergenic
1155033729 18:22006231-22006253 CTGCCATCTCTACCGGCCTGTGG - Intergenic
1155437488 18:25828127-25828149 CAGCCCCCTCGCCCAGCCTGGGG + Intergenic
1157914159 18:51648246-51648268 TAGCCTCCTTTACCAACCTGAGG + Intergenic
1158847973 18:61464591-61464613 CAGCAAGCTCTACCCTGCTGGGG - Intronic
1159796008 18:72844880-72844902 CACACACCTCATCCATCCTGAGG + Intronic
1160035012 18:75292205-75292227 CGGCCACCTGTCCCAGCCTGTGG + Intergenic
1161465874 19:4430042-4430064 CAGCCCCCTCTTGCCTCCTGCGG + Intronic
1161520260 19:4719922-4719944 CAGGCACCCCTGCCCTCCTGAGG - Exonic
1161816435 19:6502396-6502418 CAGCCCCCTCCATCATCCCGGGG - Exonic
1162599683 19:11658456-11658478 GAGCCACCTCCATCATCCTCAGG + Intergenic
1164628018 19:29742229-29742251 GAGCCACCACAACCAGCCTGGGG - Intergenic
1165427435 19:35753850-35753872 CAGACACCTCAACCAGCCAGCGG - Intronic
1166798823 19:45443817-45443839 CTCCCAACTCTACCCTCCTGTGG + Intronic
1166932883 19:46312155-46312177 CAGCCACTTCTGCAATCCTGGGG - Exonic
1167472159 19:49681331-49681353 GAGCCACCGCTCCCAGCCTGAGG + Intronic
1168035652 19:53717372-53717394 CAGCCACCACACCCAGCCTGAGG - Intergenic
926042022 2:9681009-9681031 CAGCCACCACAGCCATCCTGAGG + Intergenic
926368888 2:12160856-12160878 CAGGCAGCTCCACCATCCTGAGG - Intergenic
927175026 2:20399730-20399752 CACCCCCCACTACCATCCCGGGG - Intergenic
931858654 2:66330943-66330965 GAGCCACCTCGCCCAGCCTGGGG - Intergenic
932011340 2:67980606-67980628 CACCCACCGCCATCATCCTGGGG + Intergenic
932891178 2:75598419-75598441 CAGCCACCTCTCCAAGGCTGCGG + Intergenic
933264709 2:80169327-80169349 CAGCCACCACTATCATCCCAAGG - Intronic
935810359 2:106791451-106791473 GAGCCACCTCTACCATAGTTGGG + Intergenic
937278534 2:120701989-120702011 CAGCCCCCTATCCCATCCTCAGG - Intergenic
938066494 2:128284465-128284487 CAGCAACGCCTACCATACTGTGG + Intronic
938986329 2:136579989-136580011 CAGCCACCTCTACAATCTCTAGG - Intergenic
940376800 2:152966945-152966967 CAGGCAACTCAGCCATCCTGAGG + Intergenic
942063927 2:172252563-172252585 CAGCCACCACTACCCACCCGGGG + Intergenic
943728167 2:191273487-191273509 CAGCCATCTCTACTTTCATGAGG - Intronic
943765219 2:191653900-191653922 AAGCCACCACTCCCATCATGGGG + Intergenic
944336564 2:198541736-198541758 GAGCCACCTCACCCAGCCTGTGG + Intronic
945046888 2:205789558-205789580 CAGCTAGGTCTGCCATCCTGTGG + Intronic
948511359 2:238467351-238467373 CCACCACCTCTACCCCCCTGAGG + Intergenic
948540780 2:238690251-238690273 CTGCCAACTCTGCCATCCTGGGG + Intergenic
1169072091 20:2738964-2738986 CAGCCACCTCTACCCGGGTGGGG + Intronic
1169503926 20:6188016-6188038 CAGCCACCACTAGCCTCATGTGG + Intergenic
1170223109 20:13962367-13962389 CAGCCTCCTTTACCTTCCTGGGG + Intronic
1171404459 20:24900509-24900531 AAGACACCTCTATCTTCCTGTGG + Intergenic
1172951044 20:38723841-38723863 CAGCCACTTCTACCTTCAAGGGG + Intergenic
1173617088 20:44410277-44410299 CAGCCAACTCTCCTATCCTCCGG - Intronic
1173859968 20:46276950-46276972 CAGCCATCTCAGCCACCCTGTGG - Intronic
1174205617 20:48836210-48836232 CAGTCACATCCACAATCCTGAGG + Intergenic
1175919643 20:62444708-62444730 CATCCACCTCTCCCATCCCCTGG - Intergenic
1176082814 20:63282414-63282436 CAGCCCCATCTACCCTGCTGTGG - Intronic
1178467556 21:32861819-32861841 CAGCCTCCTATACCATCATATGG - Intergenic
1179161602 21:38904015-38904037 CAGCGACCTCTTCCCTCCCGAGG + Intergenic
1180161136 21:45999213-45999235 CAGCCACATCCACCCACCTGGGG - Exonic
1180843477 22:18969930-18969952 CCCCCACCTCTTCCTTCCTGCGG - Intergenic
1182851554 22:33478933-33478955 GAGCCACCTGCTCCATCCTGGGG - Intronic
1183362277 22:37388944-37388966 CTGTGACCTCTCCCATCCTGGGG - Intronic
952016132 3:28959153-28959175 CAGTCTCCACTACCATCCAGGGG - Intergenic
954105668 3:48408643-48408665 CAGACACCTCCACCACCCTAAGG + Intronic
955227635 3:57074113-57074135 CAGTCTCCACAACCATCCTGTGG - Exonic
956611386 3:71127076-71127098 CAGGCACCTCCACCCTACTGTGG + Intronic
957412214 3:79856724-79856746 CAACCACCTCTTCCATCTGGGGG - Intergenic
958021138 3:87997573-87997595 CAGCCACAAATACCACCCTGTGG + Intergenic
958667153 3:97155858-97155880 CAGCCACCTCTCCCTTCAAGAGG + Intronic
959500680 3:107102875-107102897 CACCCAGCTCTTCCCTCCTGGGG + Intergenic
960051211 3:113241140-113241162 CAGTGACATCTACCTTCCTGGGG - Intronic
961010197 3:123430382-123430404 CAGCCTCTGCTTCCATCCTGGGG - Intronic
961156504 3:124684247-124684269 CCCCCACCTACACCATCCTGCGG + Intronic
963936428 3:151058707-151058729 CAGCCTCCTCTTCCTCCCTGTGG + Intergenic
967303175 3:188036866-188036888 CAGCCACCTCTACAGCCCAGAGG + Intergenic
969183054 4:5456563-5456585 GAGCCACCCCTAACATGCTGTGG + Intronic
969423080 4:7108493-7108515 CAGCCACCCCTACCATGCCTCGG + Intergenic
970345806 4:15150880-15150902 CAGCCACTTCATCCAGCCTGAGG - Intergenic
970445565 4:16120892-16120914 CAGCAACTTCTACCAGCCTAAGG + Intergenic
972958563 4:44422879-44422901 CAGCCACCTCTACCATCCTGAGG - Intronic
981341379 4:143625748-143625770 CAGCCACCACTACCCTCAAGAGG + Intronic
981621157 4:146700125-146700147 CCGCCACCACTACCATCTTCAGG + Intergenic
983722360 4:170871224-170871246 CAGCTATCTCTACCAGCCTCAGG - Intergenic
984607830 4:181805342-181805364 TGGCCACCTCTACCTCCCTGCGG + Intergenic
985933489 5:3077755-3077777 CAGCCTTCTCTTCCCTCCTGGGG - Intergenic
987314975 5:16715582-16715604 GAGCCACCTCACCCAGCCTGGGG + Intronic
988991472 5:36675342-36675364 CAGCCAACTCTAGCACCATGGGG + Intronic
989339068 5:40354230-40354252 CAGCCATCTCTGCACTCCTGGGG + Intergenic
990673293 5:58156657-58156679 CAGCTAGCTTTACCATCCTAAGG + Intergenic
991357423 5:65783355-65783377 AAGACAGCTCTACCATCCTCAGG + Intronic
992554457 5:77889702-77889724 CTGCCAACTCTGCCATCCTGAGG + Intergenic
996789350 5:127275998-127276020 CAGCCACCCCTACTACCCTTTGG - Intergenic
997263105 5:132478684-132478706 CAGCCAGCTATACCCTTCTGAGG + Intergenic
997516509 5:134493666-134493688 CCACCACCTCTACCACCCTGAGG + Intergenic
1001536729 5:172503292-172503314 GAGGATCCTCTACCATCCTGTGG - Intergenic
1002427875 5:179186485-179186507 CTGCCCCCTCTACCATCCCAGGG + Intronic
1002534302 5:179867711-179867733 CAGCCACCGCCGCCTTCCTGTGG - Intronic
1002687128 5:181021480-181021502 CAGCAAGCTCTACCTGCCTGTGG + Intergenic
1004308194 6:14520145-14520167 CAGCCACCTCACCCGGCCTGGGG + Intergenic
1006019114 6:31106741-31106763 CAGTCACAACTGCCATCCTGAGG + Intergenic
1006328999 6:33375980-33376002 GAGCCACCTCGCCCAGCCTGGGG + Intergenic
1006592835 6:35170827-35170849 CACACACCTGTACCATCCTCTGG - Intergenic
1007418981 6:41707946-41707968 CTCCCAACTCTAGCATCCTGAGG - Intronic
1008504704 6:52218588-52218610 AAGCCACCAGTACCATCATGGGG - Intergenic
1008564006 6:52749658-52749680 CAACCACCTCTGCCAACTTGGGG + Intergenic
1008862226 6:56162602-56162624 AAGCCACCTCTACCATCTCCAGG - Intronic
1016071233 6:139741595-139741617 AAGCCACCAGTCCCATCCTGGGG + Intergenic
1018812391 6:167307483-167307505 CAACCATCTCAACCATCCTCTGG - Intronic
1019306031 7:336138-336160 CAGGCCCCTCTACCATCATGGGG + Intergenic
1023010122 7:35918538-35918560 CAGCCACCTCTCCCTGCCTGCGG + Intergenic
1024080703 7:45853041-45853063 CAGCCACCTCTCCCTGCCTGCGG - Intergenic
1024246731 7:47476421-47476443 CGGCCACCTCTCCCAGCCTTAGG + Intronic
1024556480 7:50607444-50607466 CAGTCAGCTCTTCCCTCCTGAGG - Intronic
1025123751 7:56328639-56328661 CAGCCACTTCTCCCTGCCTGTGG + Intergenic
1025848039 7:65217819-65217841 CAGCCACCACTCCCTGCCTGCGG + Intergenic
1025898277 7:65723684-65723706 CAGCCACCACTCCCTGCCTGCGG + Intergenic
1028424777 7:90674303-90674325 CAGCCACCTCCACCAGCTAGAGG - Intronic
1028838654 7:95401822-95401844 CAGCCACTTCTACCTTTCTGTGG - Intergenic
1029600896 7:101562931-101562953 CAGCCACCTCTCTCATTTTGGGG + Intergenic
1035092893 7:156329246-156329268 CTGGCACCTGTACCAGCCTGTGG + Intergenic
1036558639 8:9883297-9883319 CAGCCAGCACTACCATCTGGGGG + Intergenic
1037813022 8:22097890-22097912 AAGCCCCCTCTGCCCTCCTGAGG + Intronic
1037822972 8:22144136-22144158 CAGGCACCTCCATCATTCTGGGG - Intergenic
1040878461 8:52177205-52177227 CAGTTACCTCTTCCTTCCTGAGG - Intronic
1042337129 8:67640530-67640552 CAGGCATCTCTACACTCCTGGGG - Intronic
1042661389 8:71158319-71158341 CAGCTTCCTCTGTCATCCTGGGG - Intergenic
1045567408 8:103335105-103335127 CAACCACCACTTCCATCTTGTGG + Intergenic
1046383004 8:113474737-113474759 CAGCCAGCTTGGCCATCCTGTGG + Intergenic
1046732599 8:117741272-117741294 CAGCCACCTCTACAGCCATGTGG + Intergenic
1047614468 8:126551892-126551914 AAGCCACCACCACAATCCTGTGG - Intergenic
1047843471 8:128779909-128779931 CAGCCACGAATACCATCATGGGG + Intergenic
1048117689 8:131543869-131543891 TATCCACCTCTACCTTCTTGAGG - Intergenic
1049366101 8:142237588-142237610 CAGTCATCTCTGCCATCCTCAGG - Intronic
1049690536 8:143957036-143957058 CAGCCACCTCCACCTTCTTGGGG - Intronic
1051111863 9:13648602-13648624 CAGCCACCTCCACAACCCTAGGG - Intergenic
1051273713 9:15379386-15379408 GAGCCACCTCTCCCAGCCAGGGG + Intergenic
1052672543 9:31576805-31576827 AAGCCACCAGTACCATCATGGGG + Intergenic
1055426021 9:76197724-76197746 GTTCCACCTCTACCATCTTGTGG - Intronic
1055804483 9:80077204-80077226 CACCCACCTCTTCCAAGCTGTGG + Intergenic
1055818109 9:80231532-80231554 CACCCACCCCAACCACCCTGGGG - Intergenic
1058078642 9:100676944-100676966 CAGTCAGCTCTACAATTCTGAGG - Intergenic
1058104911 9:100958965-100958987 CAGCCACCTCTGCCACTATGGGG - Intergenic
1058381196 9:104378900-104378922 CAGCTTCCTCTAGCACCCTGTGG + Intergenic
1058536867 9:105970177-105970199 AAGTCAACTCTAACATCCTGGGG - Intergenic
1058826946 9:108783548-108783570 CAGCCACATCTGCTATTCTGGGG + Intergenic
1058883141 9:109302686-109302708 CAGCAAGCTCTAAGATCCTGTGG - Intronic
1059261966 9:112985944-112985966 CAGCCATGACTACCATTCTGTGG - Intergenic
1061808202 9:133148155-133148177 CAGACACGTCTACGAGCCTGTGG + Intronic
1186846869 X:13539614-13539636 CAGCCACATCTGCCATGTTGGGG - Intergenic
1187304875 X:18085920-18085942 CAGCCTCCTCTTCCTGCCTGTGG + Intergenic
1189181490 X:39008867-39008889 AAGCCACCTTTTCCCTCCTGAGG + Intergenic
1192549323 X:72041571-72041593 CAGCCCCCTCCACTCTCCTGAGG - Intergenic
1194435883 X:93868233-93868255 CGGCCACCTCTCCCCTCCAGGGG - Intergenic
1197949057 X:131874536-131874558 CAGCTACCTCTAACATCATTGGG + Intergenic
1200399127 X:156008494-156008516 CAGTCACATCTACCACCTTGGGG - Intronic
1200747462 Y:6915093-6915115 CTTCCACCTACACCATCCTGAGG - Intronic
1200796093 Y:7342606-7342628 CAGCCTCCTGTCTCATCCTGTGG + Intergenic
1201298330 Y:12484978-12485000 CAGCTACTTCAGCCATCCTGTGG - Intergenic
1201589664 Y:15601224-15601246 CAGCCTCCTCTGCCCTCCAGGGG + Intergenic