ID: 972963905

View in Genome Browser
Species Human (GRCh38)
Location 4:44486490-44486512
Sequence CACCTACAACTGCTGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972963905_972963913 25 Left 972963905 4:44486490-44486512 CCCTCCTTCAGCAGTTGTAGGTG No data
Right 972963913 4:44486538-44486560 GTGACCACACCCTGCTTGAATGG No data
972963905_972963911 -2 Left 972963905 4:44486490-44486512 CCCTCCTTCAGCAGTTGTAGGTG No data
Right 972963911 4:44486511-44486533 TGAGCAGGTGGTTAGCACAAGGG No data
972963905_972963910 -3 Left 972963905 4:44486490-44486512 CCCTCCTTCAGCAGTTGTAGGTG No data
Right 972963910 4:44486510-44486532 GTGAGCAGGTGGTTAGCACAAGG No data
972963905_972963912 3 Left 972963905 4:44486490-44486512 CCCTCCTTCAGCAGTTGTAGGTG No data
Right 972963912 4:44486516-44486538 AGGTGGTTAGCACAAGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972963905 Original CRISPR CACCTACAACTGCTGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr