ID: 972973959

View in Genome Browser
Species Human (GRCh38)
Location 4:44610530-44610552
Sequence AGCTGCCTGTAGCACCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972973958_972973959 -9 Left 972973958 4:44610516-44610538 CCAGTGATAATCTCAGCTGCCTG No data
Right 972973959 4:44610530-44610552 AGCTGCCTGTAGCACCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972973959 Original CRISPR AGCTGCCTGTAGCACCAAAC TGG Intergenic
No off target data available for this crispr