ID: 972976607

View in Genome Browser
Species Human (GRCh38)
Location 4:44643668-44643690
Sequence CTGAGGCTATGAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 757}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972976607_972976619 22 Left 972976607 4:44643668-44643690 CCCTCTTCCCTTCATAGCCTCAG 0: 1
1: 0
2: 4
3: 84
4: 757
Right 972976619 4:44643713-44643735 CCACTCCAGCTCCAGCCTTGGGG 0: 1
1: 0
2: 4
3: 46
4: 325
972976607_972976616 20 Left 972976607 4:44643668-44643690 CCCTCTTCCCTTCATAGCCTCAG 0: 1
1: 0
2: 4
3: 84
4: 757
Right 972976616 4:44643711-44643733 GGCCACTCCAGCTCCAGCCTTGG 0: 6
1: 18
2: 121
3: 488
4: 1305
972976607_972976613 -1 Left 972976607 4:44643668-44643690 CCCTCTTCCCTTCATAGCCTCAG 0: 1
1: 0
2: 4
3: 84
4: 757
Right 972976613 4:44643690-44643712 GGACATTGCTCCCTGCATTCTGG 0: 1
1: 4
2: 29
3: 86
4: 275
972976607_972976617 21 Left 972976607 4:44643668-44643690 CCCTCTTCCCTTCATAGCCTCAG 0: 1
1: 0
2: 4
3: 84
4: 757
Right 972976617 4:44643712-44643734 GCCACTCCAGCTCCAGCCTTGGG 0: 1
1: 3
2: 7
3: 59
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972976607 Original CRISPR CTGAGGCTATGAAGGGAAGA GGG (reversed) Intronic
900037376 1:427460-427482 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900059006 1:663201-663223 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
902189329 1:14750637-14750659 CTCAGGCTATGTAGAGAAAATGG - Intronic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
904279004 1:29405330-29405352 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
904857967 1:33514436-33514458 CAGAGGCTTGGAAGGGAACAGGG - Exonic
904881899 1:33706355-33706377 TGGAGGCAATGAACGGAAGATGG - Intronic
905090773 1:35429736-35429758 TTGAGGCTTTGGAGGGAACAAGG + Intergenic
906381766 1:45337006-45337028 GTTTGGCTATGAAGGGAAGGAGG - Intronic
907296168 1:53456532-53456554 CTGAAGCTATGAAGTGAATATGG + Intergenic
907866206 1:58401741-58401763 CAGAAGCTGTGAAAGGAAGAAGG - Intronic
908788617 1:67758876-67758898 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
910351100 1:86298512-86298534 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
910634906 1:89396867-89396889 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
911509862 1:98798448-98798470 CAGAGTCTGGGAAGGGAAGAGGG - Intergenic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
912068628 1:105779475-105779497 CTGAGGCTGCGTAGAGAAGAAGG - Intergenic
912233287 1:107820453-107820475 CTGAGGCTAGGAAGGGGAGTGGG + Intronic
912615694 1:111097501-111097523 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
912908148 1:113729257-113729279 CTGAGGCTGAGAAGGGTAGTGGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913417209 1:118621968-118621990 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
913459908 1:119073585-119073607 TTAAGGCTATGAGGAGAAGACGG + Intronic
914330279 1:146662914-146662936 CAGAGGATAAGAAGGGTAGAGGG + Intergenic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916011866 1:160713384-160713406 CAGAGGCTGGGAAGGGTAGAGGG + Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917389863 1:174523386-174523408 ATAAGACTATGCAGGGAAGAGGG + Intronic
917668867 1:177252726-177252748 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
917844525 1:179009396-179009418 CTGAAGCTAGAAAGGGAGGAGGG + Intergenic
918020283 1:180681045-180681067 TAGAGGCTGGGAAGGGAAGAGGG + Intronic
918430563 1:184455678-184455700 CTGGAGCTATGATGGGAACAAGG - Intronic
918494997 1:185125567-185125589 TTGAGGCTGGGAAGGGGAGAAGG + Intronic
918564690 1:185914934-185914956 CTGAGGATATCCAGGGAAGCAGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918693856 1:187517543-187517565 ATGAGGTTGTGAAGGGAAAATGG - Intergenic
919034501 1:192289276-192289298 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919598885 1:199598983-199599005 CAGAGGCTGGGAAGGGAACAGGG + Intergenic
919668340 1:200314417-200314439 CATATGCAATGAAGGGAAGAAGG + Intergenic
919956348 1:202420778-202420800 CTGAGACTATAAGGGAAAGAAGG + Intronic
920199300 1:204249709-204249731 CTGAGACTTTGAAGGGAGGAGGG - Intronic
920285407 1:204875297-204875319 GGGAGGCACTGAAGGGAAGATGG + Intronic
922299732 1:224287254-224287276 CAGAGGCTGGGAAGGGAAGGTGG + Intronic
922477657 1:225917835-225917857 GGGAGGCTGAGAAGGGAAGATGG - Intronic
922523760 1:226281260-226281282 CAGAGGCTGGGAAGGGAAAAGGG + Intronic
922859515 1:228804185-228804207 CAGAAGCTGGGAAGGGAAGAAGG - Intergenic
923215544 1:231845144-231845166 CTCAGGCTATGACGGGAAGTAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923555691 1:234998833-234998855 CTGATGATATGAAAGGCAGATGG - Intergenic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
924112121 1:240710614-240710636 CAGAGGCTAGGAAGGGGAGTGGG - Intergenic
924140572 1:241018779-241018801 CTGAAGCGATGAATGGAAGTAGG - Intronic
924421287 1:243912404-243912426 CTGTCTCTATGAAGGAAAGAAGG + Intergenic
924841522 1:247714627-247714649 CTGAACCTAAGATGGGAAGAAGG + Intergenic
924926736 1:248691474-248691496 CTTAGACTAGGTAGGGAAGAGGG + Intergenic
1063317551 10:5021110-5021132 CTGAGGCTACGGAGAGAACAGGG - Intronic
1064461624 10:15540293-15540315 CAGAGGCTGGGAAGGGAAGGTGG - Intronic
1064520214 10:16193009-16193031 TTTAGGCTATGATGGGAAGGGGG + Intergenic
1064584160 10:16822947-16822969 TTGAGCCTATGCAGGGAAGCAGG - Intergenic
1064773584 10:18750850-18750872 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1065897285 10:30175134-30175156 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1065921150 10:30393806-30393828 ATGAGACTATTAAGTGAAGAGGG - Intergenic
1065945133 10:30599307-30599329 CAGGGGCTATGAAGGGACAAAGG - Intergenic
1066491613 10:35900085-35900107 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1066556597 10:36621218-36621240 ATGAAGAAATGAAGGGAAGAAGG - Intergenic
1066685184 10:37975096-37975118 CAGAGGCTGCGAAGGGAAGTAGG + Intronic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1067359604 10:45566419-45566441 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1067762868 10:49062495-49062517 CTGAATCCATGAAGGGCAGAAGG - Intronic
1067908377 10:50318320-50318342 CTGAGGCTAGGATGGTAAAATGG - Intronic
1068307937 10:55239000-55239022 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1068542432 10:58310336-58310358 CAGAGGCTAGGAAGGGAAGTGGG + Intergenic
1069754219 10:70763509-70763531 CTGAGGCTGCGATGGAAAGAGGG - Intergenic
1071032092 10:81196840-81196862 CTTAGGCCATGACAGGAAGAGGG + Intergenic
1071109983 10:82144449-82144471 GGGAGGCCATGAATGGAAGATGG - Intronic
1071113370 10:82189112-82189134 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1071936267 10:90534165-90534187 GGGAGGCTTTGATGGGAAGAAGG - Intergenic
1073193798 10:101671612-101671634 CTGAAGCCATGACAGGAAGATGG + Intronic
1073742600 10:106425755-106425777 CTGAGGCTAGAAAGAGAATATGG - Intergenic
1073791957 10:106949492-106949514 CAGAGGCTGTGTAGGGATGAGGG - Intronic
1073881837 10:107990908-107990930 CTGATGATATGAAAGGCAGAGGG - Intergenic
1074481604 10:113826866-113826888 CTCAGGCTAGAAAGGGTAGATGG - Intergenic
1074585703 10:114766476-114766498 CTGAGGATGTGAAATGAAGATGG - Intergenic
1076261851 10:129072781-129072803 CTGAAGCTGTGAAGACAAGAAGG + Intergenic
1076964102 11:65383-65405 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1077643498 11:3902946-3902968 CTCAGGCTATGAATGACAGAGGG + Intronic
1077763855 11:5135516-5135538 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1078452493 11:11450494-11450516 CAGAGGCTATCAAGAGTAGAAGG + Intronic
1078949440 11:16113125-16113147 CCCTGGCTATGAAGGGAACAGGG - Intronic
1079625362 11:22610770-22610792 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1080192786 11:29571260-29571282 CTGAGGCTGTGCAGGGTAGTGGG + Intergenic
1080805722 11:35651511-35651533 CTCAGGCTGTGCAGGGCAGAGGG - Intergenic
1080965015 11:37204344-37204366 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1080990084 11:37522220-37522242 CAGAGGCTAAGAAGGGTAGTTGG + Intergenic
1082219047 11:49610363-49610385 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1082733160 11:56824853-56824875 CTGAGGCTTTGCAGGGCAGTAGG + Intergenic
1082780474 11:57283830-57283852 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1083420989 11:62553213-62553235 ATGAGGCTGTGAAGGAAGGAGGG + Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084229680 11:67742575-67742597 CAGAGGCCATGCAGGAAAGATGG - Intergenic
1084923925 11:72496271-72496293 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085991153 11:81846221-81846243 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1086630604 11:89014511-89014533 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1087002084 11:93431380-93431402 CTGGAGCTTAGAAGGGAAGAGGG + Intronic
1087532338 11:99400170-99400192 CAGAGGCTAAGAAGGGTAGTGGG - Intronic
1087733005 11:101799642-101799664 CAGAGGCTGGGAAAGGAAGAGGG + Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1089417522 11:118304735-118304757 CTGAGGCTGGGAGGGGAGGAGGG - Exonic
1089732984 11:120531030-120531052 CTGAGCCTATGATGGGAACCAGG - Intronic
1089761550 11:120728911-120728933 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1090137876 11:124217971-124217993 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1090449758 11:126796164-126796186 TAGAGGTCATGAAGGGAAGAAGG + Intronic
1090735086 11:129605877-129605899 TTGAGGCTAAATAGGGAAGAAGG - Intergenic
1091412567 12:253763-253785 CTGAGGCTCTGAAGAGGAGTTGG + Intronic
1092298206 12:7219344-7219366 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1092645719 12:10569887-10569909 TTGAGGCCATGATGGGAAGGAGG + Intergenic
1093476002 12:19555044-19555066 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1093581927 12:20793078-20793100 CTCAGGCCATGATGGGAAGTGGG + Intergenic
1094559893 12:31542352-31542374 CAGAGGCTGAGAAGGGTAGAAGG + Intronic
1095134282 12:38579669-38579691 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1095268096 12:40183545-40183567 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1095298479 12:40554755-40554777 CTGACCATATGAAGGCAAGATGG - Intronic
1095354349 12:41253971-41253993 TAGAGGCCAGGAAGGGAAGAGGG + Intronic
1095471499 12:42542056-42542078 ATGAAGCTATGAGAGGAAGATGG + Intronic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096014308 12:48254402-48254424 CAGAGGCTAGGAAGGGTAGTTGG + Intergenic
1096468628 12:51863076-51863098 CGCAGGCTGTGAAGGGATGAAGG - Intergenic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1096867237 12:54571903-54571925 TTGAGGCTAGGAGGGGACGAAGG - Intronic
1097296180 12:57965540-57965562 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1097619078 12:61918312-61918334 CTGAGGCTGGGAAGGGTAGTTGG - Intronic
1098047721 12:66419289-66419311 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1098165070 12:67687834-67687856 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1098291696 12:68962648-68962670 CTCAGGCCATGATGGGAAGGGGG + Intronic
1098341310 12:69454341-69454363 CAGAGGCCAGGAAGGGTAGAGGG - Intergenic
1098360154 12:69646635-69646657 CTGATGCTCTGCAGGGAAAAAGG - Intronic
1099374629 12:81884257-81884279 CTGAGGGAATCAAAGGAAGAGGG + Intergenic
1100385014 12:94098058-94098080 CCGAGGCTATTCAGGAAAGAGGG - Intergenic
1101272182 12:103159417-103159439 CTGAGGCTATGATGGTAAGTTGG + Intronic
1101589485 12:106113133-106113155 CTCAGTCTTTGAAGGGGAGAGGG - Intronic
1101690365 12:107073863-107073885 CTGAAGCTAGGAAGAGAAGTTGG - Intronic
1102431531 12:112887939-112887961 CTGAGGATCTGATGGGAGGAGGG + Intronic
1102611213 12:114114026-114114048 CTGAGGCTTAGAAGGGCAGAGGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1102847512 12:116202731-116202753 CAGAGGCTGTCAGGGGAAGAAGG - Intronic
1103222343 12:119256287-119256309 ATGATGCCAGGAAGGGAAGAGGG + Intergenic
1103768150 12:123297992-123298014 GTGCGGCTAAGAACGGAAGATGG - Exonic
1104073248 12:125366016-125366038 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1104102608 12:125627814-125627836 CAGAGGCTAGGAAGGGCAGTGGG - Intronic
1104185322 12:126425145-126425167 GTTAGGCTTTGAAGGGAAGGTGG + Intergenic
1104250385 12:127088001-127088023 CTGAGGCTCTGAGCGGAAAAAGG + Intergenic
1104403728 12:128499545-128499567 CAGAGGCTAAGAAGGGTAGTCGG - Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1105522512 13:21143605-21143627 CTGAGGGTATAAAGTCAAGACGG + Intronic
1106123047 13:26877853-26877875 CTCAGGCCATGATGGGAAGTGGG - Intergenic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1106726460 13:32491133-32491155 CTGAGATTCTGAAGGGAAAAGGG + Intronic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1107134442 13:36928467-36928489 ATGAGGCAAGGAGGGGAAGAAGG - Intergenic
1107155811 13:37165978-37166000 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1107707966 13:43125700-43125722 CAGAGGCTGGGAAGGGAAGTCGG + Intergenic
1108044262 13:46368033-46368055 CAGTGGCTATGAAGGCAAGTTGG - Exonic
1108328997 13:49366146-49366168 CAGAGGCTAGGAAGGGTAGCAGG + Intronic
1108390964 13:49947290-49947312 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1108981839 13:56523872-56523894 CTGAGGCTGAGAAGAGAAGCAGG + Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1110050726 13:70895094-70895116 TTGAGGATATCATGGGAAGATGG + Intergenic
1110411189 13:75205168-75205190 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
1110806371 13:79758790-79758812 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1112079561 13:95954347-95954369 CTCAGGCCATGATGGGAAGGGGG + Intronic
1112569888 13:100584468-100584490 CAGAGGCTAGGAAGGGTAGTAGG + Intronic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113535635 13:111064194-111064216 TTCAGGCTATGATGGGAAGCAGG + Intergenic
1113748585 13:112763282-112763304 TTCAGGCTCTGATGGGAAGAGGG + Intronic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1113809394 13:113129215-113129237 TTGAGGCCATGAGGGGAAGCAGG - Intronic
1115622154 14:35151535-35151557 ATGGGGATATGAAGGAAAGAGGG - Intronic
1116131403 14:40859270-40859292 CTGAGGCAATGAATGGCAGTGGG + Intergenic
1116560249 14:46369565-46369587 CTGAGGCAGTGAAGGGATCAGGG + Intergenic
1117263467 14:54061312-54061334 CAGAGACAAAGAAGGGAAGAAGG - Intergenic
1117607977 14:57451276-57451298 CAGAAGCCATGAAAGGAAGAAGG - Intergenic
1117708134 14:58494733-58494755 CTGGGGCTTGGAGGGGAAGAAGG + Intronic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118158605 14:63266363-63266385 TTCAGGCTATGATGGGAAGCGGG - Intronic
1118174466 14:63424198-63424220 CTGAGGCCATTAACCGAAGATGG + Intronic
1118263561 14:64271261-64271283 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1118538509 14:66795984-66796006 CAGAGGCTAGGAAGGGTAGAGGG - Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118973421 14:70656526-70656548 CTGAGGACATGAGGGAAAGATGG + Intronic
1120017528 14:79490659-79490681 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1120492818 14:85198165-85198187 CTTTGACTATGAAGGGAAGCCGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1120706558 14:87751906-87751928 CTTAGGCCAAGAAGGGAAAATGG - Intergenic
1121212502 14:92219241-92219263 CTGAGGCTGAGAAGGGTAGTGGG + Intergenic
1121561089 14:94876148-94876170 GGGAGGCTGGGAAGGGAAGATGG - Intergenic
1122654997 14:103252447-103252469 CAGAGGCTAAGAAGGGTAGTGGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1123767389 15:23495143-23495165 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1124075720 15:26442770-26442792 TTCAGGCTATGATGGGAAGAAGG - Intergenic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1124950976 15:34320476-34320498 CAGAGGCTAGGAAGGGTAGGGGG + Intronic
1124993594 15:34700384-34700406 CAGAGGCCAGGAAGGGGAGAAGG - Intergenic
1126293981 15:47116656-47116678 CAGAGTCTATGAAGGGTAGTGGG - Intergenic
1126662285 15:51044972-51044994 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1126809780 15:52390130-52390152 CAGAGGCTAGGAAGGGTAGCAGG + Intronic
1126815023 15:52446213-52446235 CTGAGGCTGTGCAGGGTAGTGGG - Intronic
1127901260 15:63342649-63342671 TTCAGGCCATGATGGGAAGAGGG - Intronic
1128655735 15:69460659-69460681 CAGAGGCTAAGGTGGGAAGATGG - Intergenic
1129414361 15:75367005-75367027 CTGAGCCAGTGAAGGGAGGAAGG + Intronic
1129735690 15:77960686-77960708 ATGAGACTATTAAGTGAAGAGGG - Intergenic
1129834945 15:78696551-78696573 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1131426831 15:92352499-92352521 CTGATTCTATTAAGGGGAGAGGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132256938 15:100384238-100384260 TTGAGGCTCTGAAGGGGACATGG + Intergenic
1132444449 15:101899800-101899822 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1132649549 16:1014311-1014333 CTGAGCCTAGGATGGGCAGAGGG - Intergenic
1132655886 16:1041501-1041523 CTGAGAGTCTCAAGGGAAGAAGG - Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133000063 16:2845781-2845803 CTCAGGCCATGATGGGAAGAGGG + Intergenic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1133902056 16:9985689-9985711 CAGAGGCTAGGAAGGGTAGTTGG + Intronic
1134128107 16:11630198-11630220 CTGAGGCTAGGAGGGGAAGTTGG - Intronic
1134642532 16:15840625-15840647 AGGAGGCTAAGACGGGAAGATGG + Intronic
1135323227 16:21510534-21510556 CTCAGGTCATGATGGGAAGAAGG + Intergenic
1135738290 16:24951286-24951308 CTGAGGCTTGGGAGGGAACAGGG - Intronic
1136271229 16:29149538-29149560 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1136334711 16:29603721-29603743 CTCAGGTCATGATGGGAAGAGGG + Intergenic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1137700620 16:50495403-50495425 GAGAGGCTATGAAGGGGAGAGGG - Intergenic
1137723393 16:50641051-50641073 CTGAGGCCATGACTGGAAAAAGG - Intergenic
1137778218 16:51074192-51074214 GTGAAGCTATGAAGGTGAGAGGG - Intergenic
1138027716 16:53535677-53535699 CTGAGGCTCTGAAGTGTTGAGGG - Intergenic
1138084174 16:54118736-54118758 CGGAGGCTGGGAAGGGAAGAAGG - Exonic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138632312 16:58307673-58307695 CTCAGGCCATGATGGGAAGAGGG + Intronic
1138633283 16:58316462-58316484 CTTAGGCCATGATGGGAAGCGGG + Intronic
1140003274 16:71047994-71048016 CAGAGGATAAGAAGGGTAGAGGG - Intronic
1140142126 16:72268184-72268206 CAGAGGCTATGAAGGGTAGTGGG - Intergenic
1140175701 16:72657526-72657548 CAGAGGCCAGGAAGGGAAGGAGG + Intergenic
1140183098 16:72740215-72740237 ATGAGGCCAAGATGGGAAGATGG + Intergenic
1140338124 16:74130854-74130876 CTGAGGCTGGGAAGGGTAGAGGG + Intergenic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141558855 16:84853673-84853695 CTGATGCTTTCCAGGGAAGATGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142057498 16:88007475-88007497 CAGAGGCTCTCAGGGGAAGACGG - Intronic
1142357901 16:89612264-89612286 TTGAGGCTGTGAAGGAAAGTGGG - Intergenic
1142658992 17:1414608-1414630 ATGAGGCTGGGAAGGGAAGGAGG + Intergenic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143288715 17:5812210-5812232 TTCAGGCCATGATGGGAAGAGGG + Intronic
1143822130 17:9573160-9573182 TTCAGGCCATGATGGGAAGAGGG + Intronic
1143943678 17:10570407-10570429 CAGAGGCTGGGAAGGGAAGTAGG - Intergenic
1144299930 17:13913705-13913727 CTCAGGCCATGATGGGAAGGGGG + Intergenic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1146465908 17:33086589-33086611 GTGAGGCTTAGAAGAGAAGAGGG - Intronic
1146513087 17:33467467-33467489 TTCAGGCTATGATGGGAAGGAGG + Intronic
1146821544 17:35986766-35986788 CTGAGACTTGGAAGGGAAGTAGG + Intronic
1147385221 17:40077147-40077169 ATGAGGGTATTAGGGGAAGAGGG - Intronic
1149077166 17:52609132-52609154 CTGAAGCTAGGCAGTGAAGATGG + Intergenic
1149110335 17:53020293-53020315 CTGAGACTGGGAAGAGAAGAAGG + Intergenic
1149121530 17:53172548-53172570 GTGATGCAAGGAAGGGAAGATGG + Intergenic
1149438827 17:56657512-56657534 ATGAAGCTGTGAGGGGAAGAAGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150009446 17:61490630-61490652 GTCAGGCTGTGAAGGGATGAAGG - Intergenic
1150023053 17:61640240-61640262 CAGAGGCTGAGAAGGGTAGAGGG + Intergenic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1152548031 17:81012742-81012764 CTGAGGCTGTATAGGGAAGTGGG - Intergenic
1152574704 17:81134865-81134887 CTGGGGCTGGGAAGGGAACATGG + Intronic
1153267705 18:3287185-3287207 CAGAGGCTAGGAAGGGTAGTCGG - Intergenic
1153430589 18:5012179-5012201 CAGAGGCTAGGAAGGGTAGTTGG + Intergenic
1153837069 18:8972853-8972875 CAGAGGCTAGGAAGGGTAGGTGG - Intergenic
1154338048 18:13481722-13481744 CTGAGGCTCTGAAGGGATCCAGG + Intronic
1156441635 18:37195255-37195277 TGAAGGCTAGGAAGGGAAGAGGG - Intronic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1157353450 18:46912075-46912097 CAAAGGCTAGGAAGGGAGGAGGG + Intronic
1157660961 18:49443346-49443368 CTGAGAGTATAAAGGGATGAGGG - Intronic
1158680908 18:59565721-59565743 CTGTAGCTAAGAGGGGAAGACGG + Intronic
1159202858 18:65209757-65209779 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1159237128 18:65691052-65691074 CAGAGGCTAGGAAGGGTAGAAGG + Intergenic
1159324362 18:66895054-66895076 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1159602989 18:70446297-70446319 CTGAGGCTAAGAGGGTGAGAAGG - Intergenic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1160290098 18:77584539-77584561 ATGAGGTTATGAATGGAACAAGG + Intergenic
1160433962 18:78832013-78832035 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434013 18:78832201-78832223 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434061 18:78832389-78832411 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434096 18:78832527-78832549 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434145 18:78832757-78832779 CAGAGGCTGAGAAGGGAAGGGGG - Intergenic
1160434160 18:78832803-78832825 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434188 18:78832899-78832921 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434211 18:78832991-78833013 CAGAGGCTGAGAAGAGAAGAAGG - Intergenic
1160555726 18:79723753-79723775 CTGAGGCCATGAAGGGCCGCAGG - Intronic
1160640905 19:135015-135037 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161220414 19:3115736-3115758 CCGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220480 19:3115929-3115951 CCGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220492 19:3115962-3115984 CCGAGGCTTTGAGGGGAGGAGGG + Intronic
1161385028 19:3986818-3986840 TTGAGGCTCTGAAAGGCAGAGGG + Intergenic
1161994941 19:7706259-7706281 CTGGGGTTACGAAGGGGAGAAGG + Intergenic
1163096409 19:15060754-15060776 CAGAGGCTGGGAAGGGAAGCGGG + Intergenic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164808999 19:31141402-31141424 CGGAGGCTGGGAGGGGAAGACGG - Intergenic
1165183582 19:33995834-33995856 CGGAGGCTGAGATGGGAAGATGG + Intergenic
1165800911 19:38549235-38549257 CTGAGGCTCAGAAGAAAAGATGG - Intronic
1166441672 19:42820971-42820993 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166449806 19:42888959-42888981 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166461111 19:42989257-42989279 CTGCAGCTAGAAAGGGAAGAAGG + Intronic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166501059 19:43341549-43341571 CTGCAGCTAGAAAGGGAAGAAGG + Intergenic
1166509041 19:43391903-43391925 CTGCAGCTAGAAAGGGAAGAAGG - Intergenic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167059558 19:47135327-47135349 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167754548 19:51403811-51403833 TCAAGGATATGAAGGGAAGAAGG + Intergenic
1168570006 19:57458803-57458825 CTGAGGCTAGGAGGAGAAGGAGG - Intronic
1168713857 19:58516156-58516178 CTGAGGCTGGGTAGGGAAGCAGG - Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925702235 2:6650409-6650431 AAGAGGCTGAGAAGGGAAGATGG + Intergenic
926025827 2:9543755-9543777 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
926272220 2:11375350-11375372 CAGAGGCTAAGAAGGGAATCTGG - Intergenic
926654806 2:15390108-15390130 CTGAGGCTAGGAAAAGAAAAGGG + Intronic
926940305 2:18128838-18128860 CAGAGGCTGGGAAGGGTAGACGG + Intronic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
928384797 2:30857972-30857994 CAGAGGCTGGGAAGGGAAGTTGG + Intergenic
928768494 2:34676629-34676651 CAGAGGCTAGGAAGGGTAGTAGG + Intergenic
928847318 2:35692763-35692785 CGGAGGCTAGGAAGGGTAGGCGG - Intergenic
928996719 2:37300363-37300385 CAGAGGCTCTGAAGGGTAGTGGG + Intronic
929048816 2:37816742-37816764 CTGAGGTTAGGAAGGGGTGACGG - Intergenic
929339792 2:40801504-40801526 GTGGAGCTATGAAGGGAGGAAGG - Intergenic
929607190 2:43242593-43242615 GGGAGGCTAAGATGGGAAGATGG - Intronic
929766782 2:44850301-44850323 CTGAGGCTAAGAGGAAAAGATGG - Intergenic
929882310 2:45847674-45847696 CTGGGGCCATGAATGGAAGCAGG - Intronic
930560888 2:52958632-52958654 CAGAGGCTACGAAGGGAATTTGG + Intergenic
930779050 2:55204920-55204942 CAGAGGCTATGAAGGGTAGTAGG + Intronic
931001421 2:57788360-57788382 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
931104383 2:59038960-59038982 CAGAGGCTAGGAAGGGTAGAGGG + Intergenic
931465601 2:62484077-62484099 CTTAAGCTTTGAAGGGAAAATGG - Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
931984950 2:67732703-67732725 TTGAGGATATCAAGGCAAGAAGG - Intergenic
932048644 2:68376919-68376941 CAGAGGCCAGGAAGGGAAGTGGG - Intronic
932186385 2:69699795-69699817 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
932833685 2:75014064-75014086 CTGAGGCAAAGAAGGGTTGAAGG - Intergenic
932841839 2:75090334-75090356 TTCAGGCCATGAAGGGAAGTGGG + Intronic
932859013 2:75269089-75269111 CAGAGGCTAGGAAGAGTAGAGGG - Intergenic
933141937 2:78801934-78801956 CTGAGTCTTTGAAGATAAGATGG - Intergenic
933347572 2:81108560-81108582 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
933833042 2:86225812-86225834 CTTAGGCTTGGAAGGCAAGAGGG - Intronic
934881364 2:97983352-97983374 TTCAGGCCATGATGGGAAGAGGG - Intronic
935035486 2:99368181-99368203 CAGAGGCTAAGAAGGTAAGGAGG + Intronic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937233160 2:120413412-120413434 CGGAGGCTGGGAAGGGTAGAGGG + Intergenic
937483352 2:122287174-122287196 CAGAGGCTGGGAAGGGAAGCAGG + Intergenic
937850088 2:126624246-126624268 CTCAGGCCATGATGGGAAGTGGG - Intergenic
937878914 2:126850542-126850564 CTGAGGCCGGGAGGGGAAGAAGG - Intergenic
939496906 2:142935794-142935816 CTGAGGGTATGAAGGGGGAAGGG + Intronic
940184286 2:150965785-150965807 CAGAGGCTGGGAAGGGTAGAAGG - Intergenic
940374037 2:152936926-152936948 CTGAGGCTTGGAAGGGTAGTGGG - Intergenic
940379969 2:153002938-153002960 CAGAGGCCAGGAAGGGTAGAGGG + Intergenic
940702846 2:157067805-157067827 CTGAGGCTAAGAAATGAAAATGG + Intergenic
940740242 2:157499064-157499086 ATGAGGCTATGATGAGATGAGGG - Intergenic
940888405 2:159011638-159011660 AGGAGGCTAAGGAGGGAAGATGG - Intronic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941456839 2:165719123-165719145 CTGAGGCTCTGAAAGGAATAAGG + Intergenic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
942724465 2:178991524-178991546 CAGAGGCTAGGAGGGTAAGAAGG + Intronic
942803626 2:179903617-179903639 GTGAGGCTGTGAAGGGCAGTGGG + Intergenic
942848159 2:180451056-180451078 CTGAGGCTGGGAAGGGTAGAAGG - Intergenic
943023537 2:182602156-182602178 CTGAGCCTATGAAGGCAGGGGGG + Intergenic
943309248 2:186306540-186306562 TTGAGGCCATGATGGGAAGGGGG + Intergenic
943708079 2:191057170-191057192 CAGAGGCTAGGAAAGGAAGCAGG - Intronic
943876144 2:193070810-193070832 CTGAGGCTGTGCAGGGCAGTGGG - Intergenic
944156703 2:196614867-196614889 CAGAGGCCAGGAAGGGTAGACGG - Intergenic
944659728 2:201911384-201911406 TTCAGGCCATGAAGGGAAGCAGG - Intergenic
944714018 2:202361114-202361136 CTGAAGCTTTGTAGGGGAGAGGG - Intergenic
945599276 2:211838322-211838344 CAGAGGCTATGTAGAGATGATGG - Intronic
946170137 2:217890265-217890287 ATGAGGCTAGGAAGGAAAGAGGG - Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947038526 2:225887806-225887828 CAGAGGCTGGGAAGGGTAGAAGG + Intergenic
947342915 2:229158920-229158942 CAGAGGCTGTGAAGGGTAGGGGG + Intronic
948115361 2:235491407-235491429 CGGAGGCTGTGCAGGGAGGATGG - Intergenic
948209852 2:236184932-236184954 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
948636059 2:239338354-239338376 CTGATGGAATGAAGGGAAGCGGG - Intronic
948671560 2:239571771-239571793 GTGAGCCTCTGATGGGAAGAGGG + Intergenic
948672588 2:239578031-239578053 CTCGGGCTATGAAGGGTAGGAGG + Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1170335015 20:15260285-15260307 CAGAAGCTATGAAAGGAAGTGGG - Intronic
1170723473 20:18904362-18904384 GTGAGGCCAGGAAGGGAAGGCGG - Intergenic
1170823766 20:19776162-19776184 CTCAGGCCATGATGGGAAGTGGG + Intergenic
1170936675 20:20816228-20816250 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1171116771 20:22531565-22531587 CTGAAGCTCTGAAAGGAACATGG + Intergenic
1171510538 20:25680125-25680147 CAGAGGCTAGGAAAGGGAGAGGG + Intronic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172444029 20:34983953-34983975 ATGAGGCTAGGATGGGGAGAAGG + Intronic
1172557616 20:35856106-35856128 CAGAGGCTAGGAAGGGTAGTAGG - Intronic
1172797160 20:37548501-37548523 CAGAGGCTGGGAAGGGTAGAGGG - Intergenic
1173038489 20:39436039-39436061 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1173190003 20:40868917-40868939 CTGAGGCTATCAAGGGGGTATGG + Intergenic
1173399291 20:42710375-42710397 CTGAGGCTGGGCAGGGCAGAAGG - Intronic
1173936593 20:46871327-46871349 CTTGGGCTATGAAGAGAACAGGG - Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1175306001 20:57975905-57975927 CTGAGGCCATGAAGGAAAGGAGG + Intergenic
1175603015 20:60290067-60290089 CTGAGGCTGTGCAGGGTAGCGGG + Intergenic
1175739898 20:61413130-61413152 CTGAGGCTGGGATGGGAAGGGGG - Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176012171 20:62903846-62903868 GTGTGGCAAAGAAGGGAAGAGGG + Intronic
1176264876 20:64203872-64203894 CGGAGCCTGTGAAGGGAGGAAGG - Intronic
1176374428 21:6080135-6080157 CAGAGGCTGAGAAGGGAAGGCGG + Intergenic
1176430746 21:6573995-6574017 CTGAGCTCATGAAGGGCAGAGGG + Intergenic
1177246490 21:18531810-18531832 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
1177295410 21:19166966-19166988 ATGTGGCAATGAAGAGAAGATGG + Intergenic
1177327144 21:19605966-19605988 CTGAGTCTAGGAAGGAAAAATGG - Intergenic
1177406333 21:20673219-20673241 CTGAGGCTATGCAGGATAGCAGG - Intergenic
1177529465 21:22340962-22340984 CTGAGGCTGTGTAGGGCAGTGGG + Intergenic
1178096033 21:29216917-29216939 CTGAGACTGTGAGGAGAAGATGG + Intronic
1178547751 21:33507386-33507408 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1178681576 21:34676597-34676619 ATGATGGTATGAAGGGAAGGGGG + Intronic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1178994666 21:37388038-37388060 AGGAGGTCATGAAGGGAAGAGGG - Intronic
1179100075 21:38348645-38348667 CTGACGGTTTGAAGGAAAGAGGG + Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179164566 21:38925435-38925457 AGGAGGCTAAGATGGGAAGATGG + Intergenic
1179706140 21:43181457-43181479 CTGAGCTCATGAAGGGCAGAGGG + Intergenic
1179749049 21:43458110-43458132 CAGAGGCTGAGAAGGGAAGTCGG - Intergenic
1180107371 21:45629033-45629055 CTGAGGCAAGAAAGGGAGGAAGG + Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181812734 22:25413840-25413862 CTGAGGCTGTGCAGGGCAGTAGG + Intergenic
1181819627 22:25465577-25465599 CAGAGGCTGGGAAGGGAAGGTGG - Intergenic
1182481817 22:30614212-30614234 CTGAGGCAATGAAGGAATGAAGG + Intronic
1182630311 22:31680145-31680167 CTGAGGCCAAGAAGGGAAACTGG + Intronic
1183376119 22:37466468-37466490 CTGAGGCACAGAAGGGGAGAAGG - Intergenic
1183383106 22:37500339-37500361 GTGAGGCTATGCTGGGGAGACGG + Intronic
1184824522 22:46939353-46939375 CTAAGGATATGAAGGGAATATGG + Intronic
1185034970 22:48469722-48469744 CAGAGGCTGGGAAGGGAAGTCGG - Intergenic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
950118559 3:10467009-10467031 CTGAGGCCAAAAAGAGAAGAAGG - Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950417539 3:12876762-12876784 AGGAGGCTTTGAAGGGAGGATGG + Intergenic
950537451 3:13587609-13587631 TTCAGGCCATGAAGGGAAGTGGG + Intronic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
951309812 3:21110839-21110861 CAGAGCCTATGAAGGGGAGTAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952536411 3:34314617-34314639 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
953320009 3:41962928-41962950 CTCAGGCAATGATGGGAAGATGG + Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954648127 3:52143800-52143822 TTTAAGGTATGAAGGGAAGAAGG - Intronic
955360877 3:58273970-58273992 CTGATGCTATGTATGCAAGAGGG - Intronic
955628826 3:60950380-60950402 AAGAGGTTATGAATGGAAGATGG - Intronic
956496550 3:69832324-69832346 CTGAGGATACGAAGTGAAGGAGG + Intronic
956716067 3:72081161-72081183 TTCAGGCCATGATGGGAAGAGGG - Intergenic
957998983 3:87727845-87727867 TTGAGGCCATGATGGGAAGTAGG + Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
958568249 3:95844171-95844193 CAGAGGCTCAGAAAGGAAGAGGG + Intergenic
959435654 3:106312097-106312119 CAAAGGCTAGGAAGGGTAGATGG - Intergenic
959462071 3:106639520-106639542 TAGAGGCTAAGAAGGGTAGAGGG - Intergenic
959707964 3:109356921-109356943 TGAAGGCTGTGAAGGGAAGACGG - Intergenic
961314962 3:126028288-126028310 CTGAGGCTGTGCAGGGCAGCAGG - Intronic
961348924 3:126286792-126286814 TTTAGGCCATGATGGGAAGAGGG - Intergenic
961643981 3:128382760-128382782 CTGAGACTACGGAGGGAAAAAGG - Intronic
961824291 3:129590769-129590791 CTGAGGCTCAGAGGGGAAAATGG + Intronic
961878315 3:130041696-130041718 CAGAGGCCATGCAGGAAAGATGG - Intergenic
961957437 3:130818520-130818542 TTCAGGCCATGATGGGAAGAGGG + Intergenic
962182838 3:133226607-133226629 CTCAGGCCATGATGGGAAGTGGG - Intronic
962252156 3:133842011-133842033 GTTAGGCCATGAAGGGAACAAGG - Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
964148310 3:153493172-153493194 CAGAGGCTGTGAAGGGTAGAAGG + Intronic
964208289 3:154199212-154199234 CAGAGGCTAGGAAGGGTAGTCGG - Intronic
964640621 3:158906434-158906456 CAGAAGCTATGAAGGGGAGGAGG - Intergenic
964810328 3:160656494-160656516 CAGAGGCTGTGAAGGGTAGTAGG + Intergenic
965290481 3:166872778-166872800 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
965857271 3:173103611-173103633 CTGAGGCTGTGCAGGGCAGTGGG + Intronic
965925929 3:173979510-173979532 GTGAGGATAAGAAGGGAAAATGG + Intronic
966054062 3:175660661-175660683 CAGAGGCTGGGAAGGGAAAAGGG - Intronic
966137360 3:176714080-176714102 CAGAGGCTTCCAAGGGAAGATGG + Intergenic
966338009 3:178892480-178892502 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
966470700 3:180285666-180285688 GTGAGGCCAGGAATGGAAGATGG - Intergenic
967710409 3:192700720-192700742 TTTAGGCCATGATGGGAAGAGGG + Intronic
968940707 4:3636115-3636137 ATCAGGCTAGGAAGGGGAGATGG - Intergenic
968940721 4:3636185-3636207 ATCAGGCTAGGAAGGGGAGATGG - Intergenic
968990534 4:3908531-3908553 CAGAGGCCATGCAGGAAAGATGG - Intergenic
969198971 4:5586477-5586499 TTCAGGCCATGAAGGGAAGGGGG + Intronic
969525597 4:7702457-7702479 CTGAGGCTCTGAGGGGTGGAGGG - Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
970097434 4:12479680-12479702 CTGAGACTGTGCAGGGCAGAGGG + Intergenic
970699847 4:18723114-18723136 ATGAGGCTTTGATGGGAAGTTGG - Intergenic
970861559 4:20709207-20709229 CTGAGGCCAGGAAGGTAAAATGG - Intronic
971076374 4:23153755-23153777 TTCAGGCCATGAAGGGAAGGTGG + Intergenic
971447160 4:26763262-26763284 TTCAGGCTATAAAGGGAAGTGGG + Intergenic
971468459 4:26991414-26991436 CAGAGGCTGGGAAGCGAAGAGGG + Intronic
971884253 4:32423388-32423410 CTGAGGCCCTGAAGGGCAGGAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973096775 4:46212253-46212275 AGGAGGCTAAGAAGGGAAGATGG + Intergenic
973398797 4:49619978-49620000 CTAAGTCAATGAAGGGAACATGG + Intergenic
973967118 4:56174443-56174465 CAGAGGCTAAGAAGGGAAGCAGG - Intronic
974417350 4:61627077-61627099 CAGAGGCAATAAAGGGTAGAGGG - Intronic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975507223 4:75150821-75150843 CAGAGGCTGGGAAGGAAAGAAGG - Intergenic
975566844 4:75765888-75765910 CTGAGGGTATTAAGTGAAGGTGG - Intronic
976038188 4:80849705-80849727 CAGAGGCTAGGGAGGGTAGAGGG + Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976212091 4:82681616-82681638 CTGGGGCTATCAAGGGTGGAGGG + Intronic
976340241 4:83939184-83939206 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
976696037 4:87920598-87920620 TTCAGACTATGATGGGAAGAGGG + Intergenic
977622448 4:99153015-99153037 TTTAGGCCATGAAGGGAAGCTGG + Intronic
977794433 4:101145620-101145642 CAGAGGCTAAGAAGGGTAGTTGG + Intronic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
979703080 4:123689534-123689556 CTGAGGCTGTGCAGGGCAGTGGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
979879466 4:125936921-125936943 CTGAGGCTGGGAAGAGTAGAAGG + Intergenic
980480264 4:133378702-133378724 CTCAGGCCATGATGGGAAGTGGG - Intergenic
980617386 4:135248117-135248139 CTGAGGAAATGAGGGGTAGAGGG - Intergenic
981360189 4:143837519-143837541 TTGAGGCTATGAAGGGTTGGGGG - Intergenic
981370966 4:143958588-143958610 TTGAGGCTATGAAGGGTTGGGGG - Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982064663 4:151643592-151643614 CAGAGGCTGGGAAGGGAAGGGGG - Intronic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982927488 4:161357169-161357191 CAGAGGCTGGGAAGGGGAGAAGG + Intergenic
984123901 4:175781298-175781320 CTGAAGAAATGAAGGGAAGGGGG + Intronic
984877981 4:184386323-184386345 CTGAGTCTGTGTTGGGAAGAAGG + Intergenic
985561064 5:586094-586116 GAGAGGGTAGGAAGGGAAGAAGG + Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
986500808 5:8397445-8397467 CAGAGGCTAGGAATGGTAGAGGG + Intergenic
986748991 5:10768719-10768741 CACAGGCTTTGAAGTGAAGAAGG + Intergenic
986931651 5:12832017-12832039 CTGAGGCTATTATCGGAAAATGG + Intergenic
986996030 5:13608337-13608359 CAGAGGCTAGGAAGGGTAGTTGG + Intergenic
987015224 5:13811071-13811093 CAGAGGCTAGGAAGGGGAGTGGG + Intronic
987481417 5:18463439-18463461 CAGAGGCTAGGAAGGGTAGCGGG + Intergenic
987695596 5:21325593-21325615 CTTTTGCTATGAAGGGATGATGG - Intergenic
987719745 5:21618025-21618047 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
987720726 5:21628745-21628767 TTCAGGCCATGAAGGGAAGCGGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
989427482 5:41313504-41313526 CTGAGTCTCTGAAGGGAATAGGG - Exonic
990443549 5:55870642-55870664 CTGAGGCCATCAAGGGGAGCTGG - Intronic
990625282 5:57603871-57603893 CTGAGGCAGTGAAGGATAGAGGG + Intergenic
990700468 5:58469626-58469648 CAGAGGCTACGAAGGGTAGTGGG - Intergenic
991042788 5:62193170-62193192 CTGAGGCTATGCAGAGTAGTAGG - Intergenic
991744807 5:69726505-69726527 CTTTTGCTATGAAGGGATGATGG + Intergenic
991752898 5:69828721-69828743 CTTTTGCTATGAAGGGATGATGG - Intergenic
991796377 5:70306233-70306255 CTTTTGCTATGAAGGGATGATGG + Intergenic
991802516 5:70385455-70385477 CTTTTGCTATGAAGGGATGATGG - Intergenic
991824187 5:70601819-70601841 CTTTTGCTATGAAGGGATGATGG + Intergenic
991832217 5:70703849-70703871 CTTTTGCTATGAAGGGATGATGG - Intergenic
991888755 5:71305789-71305811 CTTTTGCTATGAAGGGATGATGG + Intergenic
991906571 5:71519463-71519485 CAGAGGCTAGGAAGGCAAGAGGG - Intronic
992164798 5:74038780-74038802 TTCAGGCTATGATGGGAAGGGGG + Intergenic
992193023 5:74312668-74312690 CTCAGGCCATGATGGGAAGAGGG + Intergenic
992349885 5:75917658-75917680 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
992541868 5:77774042-77774064 TTCAGGCCATGATGGGAAGAGGG + Intronic
992587793 5:78259361-78259383 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
992878173 5:81078400-81078422 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
993074607 5:83213059-83213081 CTGAAGCAATGAAGGACAGAAGG + Intronic
993429105 5:87809925-87809947 CAGAGGCTGGGAAGGGGAGAAGG - Intergenic
993453810 5:88104459-88104481 ATGAAGCTGTGAAGGAAAGAAGG + Intergenic
993767581 5:91879880-91879902 CTGAGGCTAGGAAGGGCAGTGGG - Intergenic
994198504 5:96945707-96945729 CTCAGGCTATGATGGGAAGCGGG - Intronic
994340097 5:98617005-98617027 CAGAGGCTCAGAAAGGAAGAGGG - Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996450872 5:123623137-123623159 ATGAGGCTTTGAAGGGTAGCGGG - Intergenic
997002577 5:129779764-129779786 CAGAGGCTGAGAAGGGAAGTGGG + Intergenic
997060461 5:130495357-130495379 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
997416243 5:133731068-133731090 CTGATTCTATAAAGGGAAAATGG - Intergenic
997503716 5:134398918-134398940 CGGAGGCTGAGATGGGAAGATGG + Intergenic
998380951 5:141724945-141724967 CTGAGGCTGTGCAGGGGAGTGGG + Intergenic
998415322 5:141941712-141941734 CTGACACTATGATGGGAACAAGG + Exonic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
999884895 5:155911419-155911441 CAGAGGCTATTAAGGTTAGAAGG - Intronic
1001140629 5:169140842-169140864 CTGAGGTTTTGAATGGGAGAGGG - Intronic
1001734043 5:173984227-173984249 TTGAGACTAAGAAGGGAGGATGG + Intronic
1001844718 5:174911521-174911543 ATGAGACTATTAAGTGAAGAGGG - Intergenic
1001953925 5:175835047-175835069 CTGAGGCTGTGAAGGCAAGCAGG + Intronic
1002010012 5:176271563-176271585 CAGAGGCTAGGAAGGGGAGTAGG + Intronic
1002216722 5:177640741-177640763 CAGAGGCTAGGAAGGGGAGTAGG - Intergenic
1002736445 5:181391406-181391428 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1002748252 6:83418-83440 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1003010880 6:2426547-2426569 CGGAGGCTGGGAAGGGAAGCGGG - Intergenic
1003075239 6:2977939-2977961 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1003324373 6:5081584-5081606 CTAAAGCTGAGAAGGGAAGAGGG - Intergenic
1003368022 6:5495542-5495564 CTGGAGCTAGGAAGGGAAAATGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003674809 6:8193206-8193228 CTCAGGCCATGATGGGAAGATGG + Intergenic
1003708539 6:8562645-8562667 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004215519 6:13700466-13700488 CTCAGGCTAAGAAGGAAAGGTGG - Intronic
1004335452 6:14760325-14760347 TTGAAGCTAGGAAGGGAAGAGGG + Intergenic
1004517863 6:16335901-16335923 TAGAGCCTATGAAGGGAACATGG + Intronic
1005036639 6:21561389-21561411 CAGAGGCTACGAAGGGCAGTGGG - Intergenic
1005449236 6:25956904-25956926 CTCAGGCCATTAAGGGAAGTGGG - Intergenic
1005555187 6:26972473-26972495 CTTTTGCTATGAAGGGATGATGG + Intergenic
1005963412 6:30709666-30709688 CAAAGGCTAGGAAGGGTAGAGGG - Intronic
1007361510 6:41360101-41360123 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008061587 6:47003135-47003157 TTGAGGTTATGATGGGAAGTGGG + Intronic
1008210586 6:48719534-48719556 CTGAGGCTGGGAAGAGAAGTGGG - Intergenic
1009329214 6:62394985-62395007 CAGAGGCTGGGAAGGGTAGAAGG - Intergenic
1010324401 6:74548480-74548502 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1010839359 6:80629989-80630011 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1011306048 6:85927999-85928021 CAGAGGCTAGGAAGGGGAGTGGG - Intergenic
1012747420 6:103110923-103110945 CAGACTCCATGAAGGGAAGATGG - Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013607340 6:111762414-111762436 TTCAGGCCATGAAGGGAAGGTGG + Intronic
1014242698 6:119035269-119035291 TTCAGGCTATGATAGGAAGAGGG + Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014864746 6:126514914-126514936 CGGAGGCTGGGAAGGGAAGTAGG - Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015332961 6:132003024-132003046 TTTAGGCCATGATGGGAAGAGGG - Intergenic
1015483408 6:133741266-133741288 CTGAGGCTAAGAGGGGCTGAGGG + Intergenic
1016028553 6:139313880-139313902 CTCAGGCCATGATGGAAAGAGGG + Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1016295109 6:142565509-142565531 CTCAGGCCATGATGGGAAGTAGG - Intergenic
1018266909 6:162035029-162035051 CTGAGGCTCTTAAGAGAAGCAGG - Intronic
1018345539 6:162895163-162895185 TGGAGGCTGAGAAGGGAAGATGG + Intronic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1018663640 6:166113474-166113496 CTGAGGCTGTGCAGAAAAGAGGG - Intergenic
1018866480 6:167750542-167750564 TTCAGGCTGTGATGGGAAGAGGG + Intergenic
1019241543 6:170666935-170666957 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1019485216 7:1286129-1286151 CTCAGGGTATGACGGGCAGAGGG + Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020040911 7:5000207-5000229 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
1020313370 7:6886651-6886673 CAGAGGCCATGCAGGAAAGATGG - Intergenic
1021267070 7:18537929-18537951 CTGAGGTTATGAAGGACTGAAGG - Intronic
1022003181 7:26245070-26245092 CTGAGGGTTTGAAGGGAGAAGGG - Intergenic
1022005807 7:26264646-26264668 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1022475434 7:30706793-30706815 GTAAGGCTATGAGGAGAAGATGG - Intronic
1022675041 7:32491485-32491507 CTCAGTCTATGAAGGAATGATGG - Intronic
1023696425 7:42852628-42852650 GTGACACTATGAAGGGAGGAAGG - Intergenic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1024301100 7:47888529-47888551 CTGAGGCAAGGCAGCGAAGAGGG - Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024373344 7:48610852-48610874 CTGAGGTTATGCAGGGCAGTGGG + Intronic
1024531301 7:50394609-50394631 CTGAGGCTCAGAAGGGGTGATGG + Intronic
1024558882 7:50627390-50627412 CAAAGGTTATGATGGGAAGAGGG - Intronic
1024956993 7:54932963-54932985 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1024961772 7:54984133-54984155 CAGAGGCTAGGAAGGGTAGCAGG - Intergenic
1025065675 7:55853519-55853541 CAGAGGCTAAGAAGGGTAGTGGG + Intronic
1025952357 7:66155407-66155429 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1027221660 7:76218033-76218055 CTGAGGCTCAGAAAGGAAAAGGG + Intronic
1027915245 7:84309407-84309429 ATGAGGCTATGAAGGTCAGTGGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030185315 7:106755932-106755954 CTCAGGCTGTAATGGGAAGAGGG - Intergenic
1030326290 7:108222162-108222184 CAGATGATATGAAGGTAAGAAGG + Intronic
1031227147 7:119053978-119054000 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1031680745 7:124671254-124671276 CTTAGGGTAGGAAGGCAAGAAGG + Intergenic
1031726732 7:125249320-125249342 CTGAGGCTGGGAAGGGTAGTGGG - Intergenic
1032350607 7:131159554-131159576 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
1032404932 7:131649179-131649201 CTGAGGCTAGAAAGGCAGGAAGG + Intergenic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1032674257 7:134113841-134113863 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1032853423 7:135814539-135814561 CTGCGGCTGTGAAAGCAAGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033595962 7:142857748-142857770 ATGAGGCTATGAAGGGACAGAGG - Intronic
1033844179 7:145412361-145412383 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1034040239 7:147870242-147870264 CTGACCCTATGGAGGAAAGAGGG + Intronic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034872465 7:154696296-154696318 TTGAGGCTAAGATGGGCAGAGGG + Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035506573 8:141161-141183 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1035837419 8:2769684-2769706 CTGAGGCTGGGAAGGCAAGCTGG + Intergenic
1035987540 8:4451224-4451246 GGGAGGCTAAGGAGGGAAGATGG + Intronic
1036200767 8:6769822-6769844 CAGAGTCTAGGAAGGGTAGATGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037353679 8:17994180-17994202 CAGAGGCTATGAAAGGTAGTAGG - Intronic
1037894523 8:22642893-22642915 CAGATGCGAGGAAGGGAAGAGGG + Intronic
1038153961 8:24969851-24969873 CAGAGGCTGGGAAGGGTAGAGGG - Intergenic
1038506756 8:28091339-28091361 CTCAGGCCATGATGGGAAGTGGG - Intronic
1039501404 8:38020574-38020596 TTCAGGCTATGAAGGGAAAGGGG - Intergenic
1039651211 8:39340909-39340931 CTGAGCCTGTGATGGGATGATGG + Intergenic
1039675039 8:39653971-39653993 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1039685298 8:39795282-39795304 TTCAGGCCATGATGGGAAGAGGG + Intronic
1040031655 8:42830327-42830349 ATGGGGCTATGAATGGGAGATGG + Intergenic
1040363395 8:46689233-46689255 CGGAGGCTAAGAAGGGTAGTGGG - Intergenic
1040632744 8:49235038-49235060 CAGAGGCTTTGAAGGGTAGTAGG - Intergenic
1040996679 8:53409296-53409318 TTGAGGAAAGGAAGGGAAGAAGG + Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041033335 8:53760759-53760781 TTCAGGCTATGATGGGAAGAGGG + Intronic
1041368907 8:57139399-57139421 CTAAGGTTGGGAAGGGAAGAGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041876547 8:62694235-62694257 CAGAGGCTAGGAAGGGTAGTGGG - Intronic
1042082003 8:65064479-65064501 CAGAGGCTAGGAAGGGTAGTTGG - Intergenic
1042199880 8:66271112-66271134 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042983556 8:74557641-74557663 CAGAGGCTGGGAAGGAAAGAAGG + Intergenic
1043002800 8:74780085-74780107 TTCAGGCCATGATGGGAAGAAGG + Intronic
1043296180 8:78666165-78666187 GTGAGGCGATGAAGGGATGAGGG + Intronic
1043341075 8:79240396-79240418 ATGATGCTATGAAGGAAAGCTGG - Intergenic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1043916011 8:85922805-85922827 CTGAGGGAATCAGGGGAAGAAGG - Intergenic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044189544 8:89298458-89298480 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1044192516 8:89335723-89335745 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1044211969 8:89561113-89561135 TTCAGGCCATGATGGGAAGAAGG - Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044526397 8:93256542-93256564 AGGAGGATATGAAGAGAAGATGG + Intergenic
1044889679 8:96820471-96820493 CAGAGGCCAGGAAGGGGAGAGGG - Intronic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1046145013 8:110147194-110147216 CTGATGACATGAAGGGAAAAAGG + Intergenic
1046166496 8:110443256-110443278 CAGAGGCTAGGAAGGGTAGTTGG - Intergenic
1046768598 8:118097003-118097025 CTGAGGCTCTGAAGGTATAATGG + Intronic
1046859470 8:119074138-119074160 CAGAGGCTAGGAAGGGGAGTGGG + Intronic
1046971719 8:120230503-120230525 TTGAGGCCAGGAAGGGAAGCAGG - Intronic
1047048494 8:121082113-121082135 TAGAGGCTGTGAAGGGTAGAGGG - Intergenic
1047430177 8:124784376-124784398 CAGAGGCTGAGAAGGGTAGAGGG - Intergenic
1047498595 8:125426116-125426138 GTGAGGCTTGGAAGGGAAGTGGG + Intergenic
1047717974 8:127613411-127613433 TTGAGGCTATGAAGGTGGGAGGG - Intergenic
1048608338 8:135993855-135993877 CTGAGGCTGGGAAGGGTAGTGGG + Intergenic
1048730688 8:137437508-137437530 ATGGGGCTAAGAAAGGAAGAGGG - Intergenic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049292517 8:141812159-141812181 GAGAGGCTTTGAAGGGCAGAGGG + Intergenic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049722153 8:144123376-144123398 CTGAGGCTGGGAAGGGAGGTGGG + Intergenic
1050362016 9:4839187-4839209 CTCAGGCAATGAAATGAAGAAGG - Intronic
1050396643 9:5204886-5204908 CGGAAGATATGCAGGGAAGACGG + Intergenic
1050461530 9:5881474-5881496 TTGATGCTAAGCAGGGAAGAGGG + Intergenic
1050806715 9:9689643-9689665 CAGAGGCCATGAAGAGTAGAGGG - Intronic
1050952490 9:11615719-11615741 CTCAGGCTATGATGGAAAGGAGG + Intergenic
1052649122 9:31276999-31277021 CAGAGGCTAGGAAAGGAAAAGGG - Intergenic
1052927970 9:34033456-34033478 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1053438195 9:38091616-38091638 CTGAGCCTTTTAAGAGAAGAGGG - Intergenic
1053454673 9:38225042-38225064 CTGAGGCTTTCATGGGAAGCAGG - Intergenic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054779971 9:69157064-69157086 TTCAGGCCATGAAGGGAAGTGGG - Intronic
1055341720 9:75291647-75291669 CAGAGGCTAAGAAGGGTAGCAGG - Intergenic
1055357066 9:75448550-75448572 TTGAGGTTATGAAGGGAGAAAGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1056087735 9:83168993-83169015 CAGAGGCTAGGAAGGGCAGCAGG - Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1057662304 9:97013832-97013854 CTGAGGCTAGCAAGCGAGGAGGG + Intergenic
1058127811 9:101215636-101215658 CAGAGGCTGGGAAGGGAAGCAGG - Intronic
1058248354 9:102659477-102659499 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1058301077 9:103373669-103373691 TTGAGGCCATGATGGGAAGGGGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060571989 9:124650424-124650446 CAGAGGCTGGGAAGGGTAGAGGG + Intronic
1061187984 9:129066152-129066174 CTGAGCCCAGGAAGGGAAGGCGG + Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062259309 9:135652094-135652116 CTCAGGCCAAGATGGGAAGAGGG - Intergenic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1203745362 Un_GL000218v1:38200-38222 CTGAGGCTCAGATGGGCAGATGG - Intergenic
1203564746 Un_KI270744v1:81284-81306 CTGAGGCTCAGATGGGCAGATGG + Intergenic
1203601735 Un_KI270748v1:16169-16191 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1185444310 X:249810-249832 CTCAGGCCATGACAGGAAGAGGG + Intergenic
1185793871 X:2948542-2948564 GTGAGGCTATGAAGGGAGCCTGG - Intronic
1186093580 X:6075965-6075987 CTGAGGCAAGGAAGAGAATATGG + Intronic
1186534797 X:10335483-10335505 CAGAGGTTAGGAAAGGAAGAGGG + Intergenic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1187291652 X:17960091-17960113 CTAGGACTATGAAGGCAAGAAGG + Intergenic
1187487043 X:19714179-19714201 CAGAGGCTAGGAAGGGTAGTGGG + Intronic
1188625508 X:32279654-32279676 CAGAGGCTGTGAAGGGTAGTGGG + Intronic
1188947288 X:36321386-36321408 GTGGGGCCATGAGGGGAAGAGGG + Intronic
1189899427 X:45690586-45690608 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1190305491 X:49079412-49079434 TTGAGGATTTGAAGGGAAGTTGG - Intronic
1190475410 X:50822164-50822186 CAGAGGCTGGGAAGGGTAGAGGG + Intergenic
1190866940 X:54392620-54392642 TTGAGGCCATGATGGGAAGTGGG + Intergenic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1192179512 X:68907610-68907632 CTGAGGCCAGGAAGGGAGAAAGG + Intergenic
1192187757 X:68964311-68964333 CAGAGGCTAGGAAGGGTAGTGGG - Intergenic
1192824953 X:74685577-74685599 CAGAGGCTAAGAAGGGTAGTGGG - Intergenic
1193249651 X:79274572-79274594 CTGAAAATATGAAGGGAATAAGG - Intergenic
1193527536 X:82612057-82612079 CTGAGGCTGCAAAGGGCAGAGGG - Intergenic
1193680429 X:84512387-84512409 CAGAGGCTGAGAAGGGTAGAGGG + Intergenic
1194256605 X:91643101-91643123 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1194863042 X:99028056-99028078 CAGAGGCTGGGAAGGGAACAGGG + Intergenic
1194887921 X:99340883-99340905 CAGAGGCTCAGAGGGGAAGAGGG - Intergenic
1195160112 X:102162578-102162600 CTGAGGCTATGTGGGGCAGTTGG + Intergenic
1195380916 X:104269947-104269969 CAGAGACTGGGAAGGGAAGAAGG + Intergenic
1195596089 X:106691526-106691548 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1195619583 X:106939607-106939629 ATGAGGCTTTAAAGGGAAGAAGG - Intronic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1196301988 X:114058379-114058401 TTGAGGCTGTGATGGGAAGTGGG + Intergenic
1196401384 X:115320517-115320539 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1196883187 X:120218995-120219017 CAGAGGCTGTGAAGGGTAGAGGG + Intergenic
1197101276 X:122658506-122658528 CAGAGGCTAGGAAGGGTAGTAGG + Intergenic
1197642335 X:128980783-128980805 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1197876058 X:131108382-131108404 CAGAGGCTGTAAAGGGAAGTGGG - Intergenic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1198045325 X:132896109-132896131 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1198407674 X:136330994-136331016 CAGAGGCTGGGAAGGGTAGAGGG - Intronic
1198612797 X:138420605-138420627 CAGAGGCTAGGAAGGGTAGTGGG + Intergenic
1198703397 X:139420965-139420987 ATGAGGCTAGGAAGGGAAATTGG - Intergenic
1198723725 X:139653797-139653819 CAGAGGCTGGGAAGGGTAGAGGG - Intronic
1198766135 X:140080895-140080917 CTTAGACTCTGAAAGGAAGAAGG + Intergenic
1198981361 X:142399958-142399980 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1199842982 X:151669548-151669570 CAGAGGCTAGGAAGGGAATGGGG - Intronic
1199975222 X:152891102-152891124 AAGAGTCTATGAAGGGGAGAAGG + Intergenic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200383999 X:155870378-155870400 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1200575324 Y:4882379-4882401 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1201158681 Y:11153211-11153233 CTGAGGCTCAGATGGGCAGATGG - Intergenic
1201396555 Y:13554897-13554919 CTGAGACTCTGAAGAGAAAATGG + Intergenic
1201531579 Y:14995175-14995197 ATGAGGCAAAGAAGGGAAAAAGG + Intergenic
1201760087 Y:17527445-17527467 CTGAGGCTGGGAAGGGCAGTGGG - Intergenic
1201841467 Y:18378545-18378567 CTGAGGCTGGGAAGGGCAGTGGG + Intergenic
1201947361 Y:19526486-19526508 CTGAGGCCCTGAAGGGCTGAGGG - Intergenic
1201947830 Y:19531106-19531128 CTAAGGCTGTGCAGGGAAGTAGG - Intergenic
1202578246 Y:26350387-26350409 CTGAGACTATAAGGGAAAGAAGG - Intergenic