ID: 972982855

View in Genome Browser
Species Human (GRCh38)
Location 4:44726488-44726510
Sequence GTTCTTCGATGCTGGAACAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972982845_972982855 8 Left 972982845 4:44726457-44726479 CCCCCCGCTAAACTTACCGGCAG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982838_972982855 30 Left 972982838 4:44726435-44726457 CCTTCTTGGCGCCCCCGCCGCAC 0: 1
1: 0
2: 1
3: 6
4: 159
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982841_972982855 17 Left 972982841 4:44726448-44726470 CCCGCCGCACCCCCCGCTAAACT 0: 1
1: 0
2: 0
3: 4
4: 89
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982848_972982855 5 Left 972982848 4:44726460-44726482 CCCGCTAAACTTACCGGCAGACC 0: 1
1: 0
2: 0
3: 0
4: 18
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982847_972982855 6 Left 972982847 4:44726459-44726481 CCCCGCTAAACTTACCGGCAGAC 0: 1
1: 0
2: 1
3: 0
4: 12
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982843_972982855 13 Left 972982843 4:44726452-44726474 CCGCACCCCCCGCTAAACTTACC 0: 1
1: 0
2: 0
3: 7
4: 168
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982851_972982855 -8 Left 972982851 4:44726473-44726495 CCGGCAGACCCAATGGTTCTTCG 0: 1
1: 0
2: 0
3: 21
4: 263
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982849_972982855 4 Left 972982849 4:44726461-44726483 CCGCTAAACTTACCGGCAGACCC 0: 1
1: 0
2: 0
3: 1
4: 28
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982840_972982855 18 Left 972982840 4:44726447-44726469 CCCCGCCGCACCCCCCGCTAAAC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982846_972982855 7 Left 972982846 4:44726458-44726480 CCCCCGCTAAACTTACCGGCAGA 0: 1
1: 0
2: 0
3: 1
4: 24
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982842_972982855 16 Left 972982842 4:44726449-44726471 CCGCCGCACCCCCCGCTAAACTT 0: 1
1: 0
2: 0
3: 8
4: 222
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62
972982839_972982855 19 Left 972982839 4:44726446-44726468 CCCCCGCCGCACCCCCCGCTAAA 0: 1
1: 0
2: 1
3: 22
4: 231
Right 972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972982855 Original CRISPR GTTCTTCGATGCTGGAACAG CGG Exonic