ID: 972993027

View in Genome Browser
Species Human (GRCh38)
Location 4:44845980-44846002
Sequence AACTGTAACCAATACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972993022_972993027 11 Left 972993022 4:44845946-44845968 CCTCTCCCACTGAAATCTAATTC No data
Right 972993027 4:44845980-44846002 AACTGTAACCAATACATGGAAGG No data
972993023_972993027 6 Left 972993023 4:44845951-44845973 CCCACTGAAATCTAATTCCTGCT No data
Right 972993027 4:44845980-44846002 AACTGTAACCAATACATGGAAGG No data
972993024_972993027 5 Left 972993024 4:44845952-44845974 CCACTGAAATCTAATTCCTGCTA No data
Right 972993027 4:44845980-44846002 AACTGTAACCAATACATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972993027 Original CRISPR AACTGTAACCAATACATGGA AGG Intergenic
No off target data available for this crispr