ID: 972999310

View in Genome Browser
Species Human (GRCh38)
Location 4:44926008-44926030
Sequence AGCAAGGAGGCCATTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972999308_972999310 -9 Left 972999308 4:44925994-44926016 CCTATTCAAGTGACAGCAAGGAG No data
Right 972999310 4:44926008-44926030 AGCAAGGAGGCCATTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972999310 Original CRISPR AGCAAGGAGGCCATTGTCAC TGG Intergenic
No off target data available for this crispr