ID: 972999313

View in Genome Browser
Species Human (GRCh38)
Location 4:44926036-44926058
Sequence AGTGAATGAGAGGTAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972999311_972999313 -5 Left 972999311 4:44926018-44926040 CCATTGTCACTGGAGTGAAGTGA No data
Right 972999313 4:44926036-44926058 AGTGAATGAGAGGTAGAGCAAGG No data
972999308_972999313 19 Left 972999308 4:44925994-44926016 CCTATTCAAGTGACAGCAAGGAG No data
Right 972999313 4:44926036-44926058 AGTGAATGAGAGGTAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972999313 Original CRISPR AGTGAATGAGAGGTAGAGCA AGG Intergenic
No off target data available for this crispr