ID: 972999515

View in Genome Browser
Species Human (GRCh38)
Location 4:44928424-44928446
Sequence CAGGATGGCCATTATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972999509_972999515 5 Left 972999509 4:44928396-44928418 CCAATTCCCTCTGTCTCTGGGAC No data
Right 972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG No data
972999510_972999515 -1 Left 972999510 4:44928402-44928424 CCCTCTGTCTCTGGGACATGCTC No data
Right 972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG No data
972999511_972999515 -2 Left 972999511 4:44928403-44928425 CCTCTGTCTCTGGGACATGCTCA No data
Right 972999515 4:44928424-44928446 CAGGATGGCCATTATGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972999515 Original CRISPR CAGGATGGCCATTATGGAGT TGG Intergenic
No off target data available for this crispr