ID: 973004264

View in Genome Browser
Species Human (GRCh38)
Location 4:44989516-44989538
Sequence CAGCCGCCTGCAATTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973004257_973004264 29 Left 973004257 4:44989464-44989486 CCTTTGTCAGGCTTATAAAATTG No data
Right 973004264 4:44989516-44989538 CAGCCGCCTGCAATTGGTTCAGG No data
973004260_973004264 4 Left 973004260 4:44989489-44989511 CCAGCAATGGTAGTGGCCATCAT No data
Right 973004264 4:44989516-44989538 CAGCCGCCTGCAATTGGTTCAGG No data
973004256_973004264 30 Left 973004256 4:44989463-44989485 CCCTTTGTCAGGCTTATAAAATT No data
Right 973004264 4:44989516-44989538 CAGCCGCCTGCAATTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973004264 Original CRISPR CAGCCGCCTGCAATTGGTTC AGG Intergenic
No off target data available for this crispr