ID: 973007330

View in Genome Browser
Species Human (GRCh38)
Location 4:45029324-45029346
Sequence TTGGATCTAGGTGGTATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973007324_973007330 5 Left 973007324 4:45029296-45029318 CCTAACTGGAGAGTGGAGAGACG No data
Right 973007330 4:45029324-45029346 TTGGATCTAGGTGGTATTGATGG No data
973007321_973007330 30 Left 973007321 4:45029271-45029293 CCAGTTAGGCGGCTGTAGCAGTA No data
Right 973007330 4:45029324-45029346 TTGGATCTAGGTGGTATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973007330 Original CRISPR TTGGATCTAGGTGGTATTGA TGG Intergenic
No off target data available for this crispr