ID: 973012824

View in Genome Browser
Species Human (GRCh38)
Location 4:45097551-45097573
Sequence TAGTTAGGAGGTAAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973012818_973012824 26 Left 973012818 4:45097502-45097524 CCTATATCTAGCATATGTTTATA No data
Right 973012824 4:45097551-45097573 TAGTTAGGAGGTAAGATGAATGG No data
973012821_973012824 -4 Left 973012821 4:45097532-45097554 CCTTAAGGAATCTGCAACGTAGT No data
Right 973012824 4:45097551-45097573 TAGTTAGGAGGTAAGATGAATGG No data
973012820_973012824 -3 Left 973012820 4:45097531-45097553 CCCTTAAGGAATCTGCAACGTAG No data
Right 973012824 4:45097551-45097573 TAGTTAGGAGGTAAGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973012824 Original CRISPR TAGTTAGGAGGTAAGATGAA TGG Intergenic
No off target data available for this crispr