ID: 973014520

View in Genome Browser
Species Human (GRCh38)
Location 4:45121146-45121168
Sequence ACTACATTTTTAGCTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973014520_973014522 17 Left 973014520 4:45121146-45121168 CCAGAAGCAGCTAAAAATGTAGT No data
Right 973014522 4:45121186-45121208 TACATTTATCTTGTGTTTTTTGG No data
973014520_973014523 18 Left 973014520 4:45121146-45121168 CCAGAAGCAGCTAAAAATGTAGT No data
Right 973014523 4:45121187-45121209 ACATTTATCTTGTGTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973014520 Original CRISPR ACTACATTTTTAGCTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr