ID: 973014523

View in Genome Browser
Species Human (GRCh38)
Location 4:45121187-45121209
Sequence ACATTTATCTTGTGTTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973014520_973014523 18 Left 973014520 4:45121146-45121168 CCAGAAGCAGCTAAAAATGTAGT No data
Right 973014523 4:45121187-45121209 ACATTTATCTTGTGTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973014523 Original CRISPR ACATTTATCTTGTGTTTTTT GGG Intergenic
No off target data available for this crispr