ID: 973021759

View in Genome Browser
Species Human (GRCh38)
Location 4:45211465-45211487
Sequence CCAAGAGGCAGTTGCACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973021759_973021765 12 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021765 4:45211500-45211522 TTCTGAAGGGTCACCACACATGG No data
973021759_973021768 23 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021768 4:45211511-45211533 CACCACACATGGGGTTGTTGTGG No data
973021759_973021767 14 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021767 4:45211502-45211524 CTGAAGGGTCACCACACATGGGG No data
973021759_973021762 -2 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021762 4:45211486-45211508 GGTCCTGTAAGTTCTTCTGAAGG No data
973021759_973021766 13 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021766 4:45211501-45211523 TCTGAAGGGTCACCACACATGGG No data
973021759_973021763 -1 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021763 4:45211487-45211509 GTCCTGTAAGTTCTTCTGAAGGG No data
973021759_973021769 24 Left 973021759 4:45211465-45211487 CCATAAGTGCAACTGCCTCTTGG No data
Right 973021769 4:45211512-45211534 ACCACACATGGGGTTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973021759 Original CRISPR CCAAGAGGCAGTTGCACTTA TGG (reversed) Intergenic
No off target data available for this crispr