ID: 973024171

View in Genome Browser
Species Human (GRCh38)
Location 4:45246272-45246294
Sequence AGTTATTTGAAGATGATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973024171_973024173 21 Left 973024171 4:45246272-45246294 CCAGTAATCATCTTCAAATAACT No data
Right 973024173 4:45246316-45246338 AGTGGCTGTGCTGAAAGCATAGG No data
973024171_973024172 3 Left 973024171 4:45246272-45246294 CCAGTAATCATCTTCAAATAACT No data
Right 973024172 4:45246298-45246320 TCTTAATAATTCTTTGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973024171 Original CRISPR AGTTATTTGAAGATGATTAC TGG (reversed) Intergenic
No off target data available for this crispr