ID: 973024595

View in Genome Browser
Species Human (GRCh38)
Location 4:45251500-45251522
Sequence CACCATTTCTAGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973024595_973024603 7 Left 973024595 4:45251500-45251522 CCATCCACCATCTAGAAATGGTG No data
Right 973024603 4:45251530-45251552 GGAAACTCCTGGCATTGTGTTGG No data
973024595_973024605 16 Left 973024595 4:45251500-45251522 CCATCCACCATCTAGAAATGGTG No data
Right 973024605 4:45251539-45251561 TGGCATTGTGTTGGTCGAGCTGG No data
973024595_973024602 -4 Left 973024595 4:45251500-45251522 CCATCCACCATCTAGAAATGGTG No data
Right 973024602 4:45251519-45251541 GGTGGGAGGCTGGAAACTCCTGG No data
973024595_973024606 30 Left 973024595 4:45251500-45251522 CCATCCACCATCTAGAAATGGTG No data
Right 973024606 4:45251553-45251575 TCGAGCTGGCATGCACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973024595 Original CRISPR CACCATTTCTAGATGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr