ID: 973026236

View in Genome Browser
Species Human (GRCh38)
Location 4:45275656-45275678
Sequence ATTATTCAGCCTACACCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973026235_973026236 2 Left 973026235 4:45275631-45275653 CCAGAGAATGATAGCATTCTGGA No data
Right 973026236 4:45275656-45275678 ATTATTCAGCCTACACCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973026236 Original CRISPR ATTATTCAGCCTACACCATG TGG Intergenic
No off target data available for this crispr