ID: 973026236 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:45275656-45275678 |
| Sequence | ATTATTCAGCCTACACCATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973026235_973026236 | 2 | Left | 973026235 | 4:45275631-45275653 | CCAGAGAATGATAGCATTCTGGA | No data | ||
| Right | 973026236 | 4:45275656-45275678 | ATTATTCAGCCTACACCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973026236 | Original CRISPR | ATTATTCAGCCTACACCATG TGG | Intergenic | ||
| No off target data available for this crispr | |||||