ID: 973028133

View in Genome Browser
Species Human (GRCh38)
Location 4:45299906-45299928
Sequence TTGGTTTAGCACCATCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973028130_973028133 2 Left 973028130 4:45299881-45299903 CCCATGGGCTGCAGGTTGGACAA No data
Right 973028133 4:45299906-45299928 TTGGTTTAGCACCATCCTCTAGG No data
973028131_973028133 1 Left 973028131 4:45299882-45299904 CCATGGGCTGCAGGTTGGACAAG No data
Right 973028133 4:45299906-45299928 TTGGTTTAGCACCATCCTCTAGG No data
973028125_973028133 18 Left 973028125 4:45299865-45299887 CCTGGGCTGCACACAGCCCATGG No data
Right 973028133 4:45299906-45299928 TTGGTTTAGCACCATCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973028133 Original CRISPR TTGGTTTAGCACCATCCTCT AGG Intergenic
No off target data available for this crispr