ID: 973029812

View in Genome Browser
Species Human (GRCh38)
Location 4:45323572-45323594
Sequence TTCCTTGTTGAAGAGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973029812_973029813 -1 Left 973029812 4:45323572-45323594 CCATATGACTCTTCAACAAGGAA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 973029813 4:45323594-45323616 AGCTCAGCTGAGAACATGTCTGG 0: 1
1: 1
2: 1
3: 23
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973029812 Original CRISPR TTCCTTGTTGAAGAGTCATA TGG (reversed) Intergenic