ID: 973030581

View in Genome Browser
Species Human (GRCh38)
Location 4:45332368-45332390
Sequence GAGCAGTATTTTTTCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973030578_973030581 -9 Left 973030578 4:45332354-45332376 CCCATCTGAAAACAGAGCAGTAT No data
Right 973030581 4:45332368-45332390 GAGCAGTATTTTTTCCTGCTGGG No data
973030577_973030581 -8 Left 973030577 4:45332353-45332375 CCCCATCTGAAAACAGAGCAGTA No data
Right 973030581 4:45332368-45332390 GAGCAGTATTTTTTCCTGCTGGG No data
973030579_973030581 -10 Left 973030579 4:45332355-45332377 CCATCTGAAAACAGAGCAGTATT No data
Right 973030581 4:45332368-45332390 GAGCAGTATTTTTTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973030581 Original CRISPR GAGCAGTATTTTTTCCTGCT GGG Intergenic
No off target data available for this crispr