ID: 973034997

View in Genome Browser
Species Human (GRCh38)
Location 4:45395254-45395276
Sequence ATCTACTGACACCTTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973034997_973035002 17 Left 973034997 4:45395254-45395276 CCAAAATCAAGGTGTCAGTAGAT No data
Right 973035002 4:45395294-45395316 CTGTCTATATGGCTTGTAGATGG No data
973034997_973035000 6 Left 973034997 4:45395254-45395276 CCAAAATCAAGGTGTCAGTAGAT No data
Right 973035000 4:45395283-45395305 ACTTCTGAGGCCTGTCTATATGG No data
973034997_973034999 -7 Left 973034997 4:45395254-45395276 CCAAAATCAAGGTGTCAGTAGAT No data
Right 973034999 4:45395270-45395292 AGTAGATTTGGTTACTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973034997 Original CRISPR ATCTACTGACACCTTGATTT TGG (reversed) Intergenic
No off target data available for this crispr