ID: 973035002

View in Genome Browser
Species Human (GRCh38)
Location 4:45395294-45395316
Sequence CTGTCTATATGGCTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973034997_973035002 17 Left 973034997 4:45395254-45395276 CCAAAATCAAGGTGTCAGTAGAT No data
Right 973035002 4:45395294-45395316 CTGTCTATATGGCTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973035002 Original CRISPR CTGTCTATATGGCTTGTAGA TGG Intergenic
No off target data available for this crispr