ID: 973041629

View in Genome Browser
Species Human (GRCh38)
Location 4:45476468-45476490
Sequence GGCACTGTCTCCGTAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973041624_973041629 8 Left 973041624 4:45476437-45476459 CCAAACCTCTAATAAGATGGTAT No data
Right 973041629 4:45476468-45476490 GGCACTGTCTCCGTAATTGGTGG No data
973041623_973041629 9 Left 973041623 4:45476436-45476458 CCCAAACCTCTAATAAGATGGTA No data
Right 973041629 4:45476468-45476490 GGCACTGTCTCCGTAATTGGTGG No data
973041621_973041629 30 Left 973041621 4:45476415-45476437 CCACAAATTCATAAGTTGAAACC 0: 4
1: 98
2: 697
3: 2090
4: 3654
Right 973041629 4:45476468-45476490 GGCACTGTCTCCGTAATTGGTGG No data
973041626_973041629 3 Left 973041626 4:45476442-45476464 CCTCTAATAAGATGGTATCAGGA No data
Right 973041629 4:45476468-45476490 GGCACTGTCTCCGTAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973041629 Original CRISPR GGCACTGTCTCCGTAATTGG TGG Intergenic
No off target data available for this crispr