ID: 973048001

View in Genome Browser
Species Human (GRCh38)
Location 4:45559819-45559841
Sequence ACAATCAGTGTTGTGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973048001_973048002 26 Left 973048001 4:45559819-45559841 CCTCATTACACAACACTGATTGT No data
Right 973048002 4:45559868-45559890 ATTTCTTACAGCAAAATAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973048001 Original CRISPR ACAATCAGTGTTGTGTAATG AGG (reversed) Intergenic