ID: 973073533

View in Genome Browser
Species Human (GRCh38)
Location 4:45895129-45895151
Sequence GAGAACATTTTGAAGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973073533_973073535 11 Left 973073533 4:45895129-45895151 CCAGCAATCTTCAAAATGTTCTC No data
Right 973073535 4:45895163-45895185 CTTTTTCATTCTTTTCAACATGG No data
973073533_973073537 18 Left 973073533 4:45895129-45895151 CCAGCAATCTTCAAAATGTTCTC No data
Right 973073537 4:45895170-45895192 ATTCTTTTCAACATGGCCCAGGG No data
973073533_973073536 17 Left 973073533 4:45895129-45895151 CCAGCAATCTTCAAAATGTTCTC No data
Right 973073536 4:45895169-45895191 CATTCTTTTCAACATGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973073533 Original CRISPR GAGAACATTTTGAAGATTGC TGG (reversed) Intergenic
No off target data available for this crispr