ID: 973073925

View in Genome Browser
Species Human (GRCh38)
Location 4:45899551-45899573
Sequence AGGAAGAGCAAAATGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973073915_973073925 24 Left 973073915 4:45899504-45899526 CCCAACCCCAGGCAACACAGAGT No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data
973073916_973073925 23 Left 973073916 4:45899505-45899527 CCAACCCCAGGCAACACAGAGTG No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data
973073914_973073925 25 Left 973073914 4:45899503-45899525 CCCCAACCCCAGGCAACACAGAG No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data
973073913_973073925 30 Left 973073913 4:45899498-45899520 CCTTTCCCCAACCCCAGGCAACA No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data
973073920_973073925 17 Left 973073920 4:45899511-45899533 CCAGGCAACACAGAGTGGAGAAA No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data
973073918_973073925 19 Left 973073918 4:45899509-45899531 CCCCAGGCAACACAGAGTGGAGA No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data
973073919_973073925 18 Left 973073919 4:45899510-45899532 CCCAGGCAACACAGAGTGGAGAA No data
Right 973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973073925 Original CRISPR AGGAAGAGCAAAATGACTGT GGG Intergenic
No off target data available for this crispr