ID: 973084259

View in Genome Browser
Species Human (GRCh38)
Location 4:46035186-46035208
Sequence CAGGGGATGACTGCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973084259_973084264 17 Left 973084259 4:46035186-46035208 CCAGAAACAGCAGTCATCCCCTG No data
Right 973084264 4:46035226-46035248 AAAATAGCATATCTGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973084259 Original CRISPR CAGGGGATGACTGCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr