ID: 973084264

View in Genome Browser
Species Human (GRCh38)
Location 4:46035226-46035248
Sequence AAAATAGCATATCTGTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973084260_973084264 0 Left 973084260 4:46035203-46035225 CCCCTGCCTTCTTCAGCTTTATG No data
Right 973084264 4:46035226-46035248 AAAATAGCATATCTGTTATTTGG No data
973084259_973084264 17 Left 973084259 4:46035186-46035208 CCAGAAACAGCAGTCATCCCCTG No data
Right 973084264 4:46035226-46035248 AAAATAGCATATCTGTTATTTGG No data
973084261_973084264 -1 Left 973084261 4:46035204-46035226 CCCTGCCTTCTTCAGCTTTATGA No data
Right 973084264 4:46035226-46035248 AAAATAGCATATCTGTTATTTGG No data
973084263_973084264 -6 Left 973084263 4:46035209-46035231 CCTTCTTCAGCTTTATGAAAATA 0: 1
1: 0
2: 7
3: 36
4: 375
Right 973084264 4:46035226-46035248 AAAATAGCATATCTGTTATTTGG No data
973084262_973084264 -2 Left 973084262 4:46035205-46035227 CCTGCCTTCTTCAGCTTTATGAA No data
Right 973084264 4:46035226-46035248 AAAATAGCATATCTGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973084264 Original CRISPR AAAATAGCATATCTGTTATT TGG Intergenic
No off target data available for this crispr