ID: 973085360

View in Genome Browser
Species Human (GRCh38)
Location 4:46052672-46052694
Sequence GCTCATGGGGCCATATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973085360 Original CRISPR GCTCATGGGGCCATATTTAC TGG (reversed) Intronic
903818356 1:26081758-26081780 GCTCTTGGAGCCAGATTTAGTGG - Intergenic
910624998 1:89297065-89297087 TCTCATGGAGCCATATTAAATGG - Intergenic
912347220 1:108975227-108975249 GCTCTTGGGGGCATATATTCAGG + Intronic
1064855858 10:19766607-19766629 GCTCTTGGGGCCTTATGTAATGG + Intronic
1070809899 10:79292440-79292462 GCTTATGGGGCCATGTGTGCTGG + Intronic
1078348554 11:10573509-10573531 GCTCATGAGTCCATCTTTTCTGG - Exonic
1078781040 11:14439768-14439790 CTTCATGGGTCCATGTTTACAGG + Intergenic
1081585650 11:44382053-44382075 GCTCCTGGGGCCGTCTTTGCAGG - Intergenic
1082701062 11:56431433-56431455 TTTCATGGGGACATATTAACTGG - Intergenic
1082704204 11:56473400-56473422 TCCCATGGGGCCATTTCTACGGG - Intergenic
1099091073 12:78309178-78309200 CCTCATGAGGATATATTTACAGG + Intergenic
1100909371 12:99340024-99340046 ACTTATGGGGTCATATTGACAGG + Intronic
1106638467 13:31557407-31557429 CATCATGGGGCCATTTTTAAAGG + Intergenic
1113121135 13:106924836-106924858 CCTCATGGTGCCATCTTCACTGG - Intergenic
1118357384 14:65026123-65026145 GTTCATGGGGCCTTCTTTCCTGG - Intronic
1120214545 14:81668223-81668245 GCTGATTGGTCCATTTTTACAGG + Intergenic
1124107921 15:26758210-26758232 GCTCATGCTGCCATATTAATAGG - Intronic
1124141605 15:27081859-27081881 GCTCTTGGAGCTATATTTCCTGG + Intronic
1126969428 15:54093801-54093823 GCTCATGCTGTCATATTTTCAGG - Intronic
1129184717 15:73899121-73899143 GCTCCTGGTACCATCTTTACAGG + Intergenic
1130125712 15:81092445-81092467 GCTCATGTTGCTATAATTACCGG - Intronic
1134295261 16:12939956-12939978 GGTCCTGAGGCCATATTTTCAGG + Intronic
1138131264 16:54482073-54482095 GCACACGAGGCCATATTTAAGGG - Intergenic
1140806043 16:78533162-78533184 GCTCCTGAGGCTATCTTTACAGG + Intronic
1142915661 17:3134666-3134688 ACTCATGGGGCCATTTCTACAGG - Intergenic
1144143645 17:12375918-12375940 GGTCATGGTACCATATTTCCTGG - Intergenic
1151847721 17:76669107-76669129 GCTCATGGTGCCATTCTGACTGG + Intergenic
1155674262 18:28410327-28410349 GTTCCTGGGGCACTATTTACTGG + Intergenic
1156889890 18:42178595-42178617 GCTTGTGGGTCCATTTTTACTGG - Intergenic
1167398889 19:49251725-49251747 GCTCATGGGGCCACAATCAGTGG - Intergenic
929579843 2:43074857-43074879 GCTCAGTGGGCCATCTTTTCTGG + Intergenic
941472391 2:165904090-165904112 GCTCATGGGACCATGGTGACTGG + Intronic
1172056455 20:32157772-32157794 CCTCATGGTGCCATGTCTACAGG + Exonic
1173178375 20:40782876-40782898 GCTCTTGGGTCCACATCTACAGG + Intergenic
1174436930 20:50515047-50515069 GATGATGGGACCATATTAACGGG - Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1175032233 20:55966384-55966406 GCTCATGGGGTGAGATTTAATGG - Intergenic
1179011835 21:37562529-37562551 CCACATGTGGCCATATTCACAGG - Intergenic
1181338150 22:22156968-22156990 GCTCCTGGGTCCATACTCACTGG + Intergenic
1185027022 22:48420454-48420476 CCAAATAGGGCCATATTTACAGG + Intergenic
952759214 3:36899016-36899038 GCTCATGGGGAGATACTTTCTGG - Intronic
956304463 3:67808880-67808902 TCTCATGGGGGCATATTTGGGGG + Intergenic
960053575 3:113260470-113260492 GGTCATGGAGCCAAATTCACTGG - Intronic
973085360 4:46052672-46052694 GCTCATGGGGCCATATTTACTGG - Intronic
980627194 4:135388879-135388901 GCCCATGGGGCCTTAATCACTGG - Intergenic
981941462 4:150286001-150286023 GCTCCTCGGGCCATTTTGACCGG - Exonic
983773038 4:171573641-171573663 GCTAATTGAGCCATATTCACTGG + Intergenic
986635475 5:9818227-9818249 GCTCATTTGGCCATATTAAGGGG + Intergenic
988358739 5:30208566-30208588 CCTCATGAGGCCATAAATACAGG + Intergenic
990419091 5:55614324-55614346 GCTCATTGGTCCATTTTGACAGG - Intergenic
990492235 5:56313883-56313905 GCTCCTGGGTCCATATGTACTGG - Intergenic
992694596 5:79273784-79273806 ACTCATGGGGCAATATTAAAAGG - Intronic
993661953 5:90648481-90648503 GCTCATGGGGGCATCTCTATAGG - Intronic
994043192 5:95281497-95281519 GCTCATGGGGCCTTGTTCTCTGG - Intronic
1000230983 5:159314905-159314927 CTTCATGGAGCCATATTTTCTGG + Exonic
1000340305 5:160272015-160272037 GCAAATGGGGCAATATTTCCAGG - Intronic
1000699736 5:164433875-164433897 GCTGATGGGGCCACAGTTGCTGG + Intergenic
1021968661 7:25946919-25946941 GTTCATGGGGCCTTATATACAGG - Intergenic
1028000530 7:85492277-85492299 GCTCATGTGCCCATTTTTATAGG - Intergenic
1035896549 8:3409290-3409312 GCTCGGGGTGCCACATTTACTGG - Intronic
1038434456 8:27525471-27525493 GCCCTTGGTGCCATACTTACTGG - Exonic
1041588493 8:59547944-59547966 GCTGATTGGTCCATATTGACAGG - Intergenic
1042487507 8:69362727-69362749 GCTCATGGGGCCATAGGTGAAGG + Intergenic
1055957976 9:81792207-81792229 GCTCAGGGTGGCATATTTCCTGG + Intergenic
1057576366 9:96245780-96245802 GCTCATGTGGTCACATTTAAGGG - Intronic
1185620324 X:1450065-1450087 GGTGATGGGGGCATAGTTACTGG - Intronic
1189643978 X:43106431-43106453 GCTCATGTTGCCATTTTTCCTGG + Intergenic
1191760628 X:64643952-64643974 GGTCTTGGGGCCATTTTTCCTGG + Intergenic
1191997809 X:67115231-67115253 GCTCATGAGTCCATGTTAACTGG - Intergenic
1199572972 X:149286736-149286758 GCTCAATGGGCCATGTTTGCAGG + Intergenic