ID: 973086273

View in Genome Browser
Species Human (GRCh38)
Location 4:46065385-46065407
Sequence CTGCTTCGAATTTGGAATGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973086273 Original CRISPR CTGCTTCGAATTTGGAATGA TGG (reversed) Exonic
902704162 1:18192992-18193014 CTGCTGCCCATTTGGAGTGAAGG - Intronic
906124241 1:43417000-43417022 CTGCAGCTAATTTGGATTGATGG + Intronic
913356940 1:117932273-117932295 CTGCTCTGATTTTGAAATGAAGG + Intronic
913601636 1:120426784-120426806 CTGCCTCTAATGTGAAATGATGG + Intergenic
919344879 1:196362517-196362539 CTGCTTGGAATTTGGGTTCAAGG + Intronic
920550587 1:206857343-206857365 GTGCTTTGAATTTGAAATTAGGG + Intergenic
921769267 1:219015994-219016016 CTGCTTTGCATTTGGGTTGAAGG - Intergenic
923524319 1:234760443-234760465 CTGCTTCTCATTGGGAAGGAAGG - Intergenic
1066263020 10:33747445-33747467 CTGCTTCTAATTTGGTATAAAGG + Intergenic
1067838049 10:49653707-49653729 CTGCCTGGCATTTGGAATGGTGG + Intronic
1069760652 10:70808934-70808956 CTGCTACAAATTGGGAATGTAGG - Intergenic
1070586987 10:77774005-77774027 CTGCTACTAATCTGGAAAGAAGG - Intergenic
1073671245 10:105592712-105592734 CTGCTACTAATTTGTAAGGATGG + Intergenic
1074647102 10:115469038-115469060 CTGTTTATAATTTTGAATGAAGG - Intronic
1078480941 11:11674742-11674764 CTGCTTGGAATGTGCAAGGATGG + Intergenic
1078982911 11:16558603-16558625 CTCCTTCGTATTTAGAATGTTGG - Intronic
1080763615 11:35275964-35275986 CTGCTTTGAATTAGTAATGGTGG - Intronic
1089127842 11:116189979-116190001 CTGCTGAGAATTTGAAATAAAGG - Intergenic
1089423139 11:118346871-118346893 CTGAATCCAATTTAGAATGAGGG + Intronic
1096647357 12:53046162-53046184 CTCCTGCGAACTGGGAATGACGG + Intergenic
1097257700 12:57693058-57693080 CTGATTGGAAAGTGGAATGAGGG + Intergenic
1106003067 13:25742922-25742944 CAGCTTCCAATTTGGAAGGGAGG + Intronic
1106264635 13:28099655-28099677 CTGAATCGAATTTGGGTTGAAGG - Intronic
1106840171 13:33678343-33678365 CTGATTCGCAGTTGGAATGGGGG + Intergenic
1109720618 13:66271373-66271395 CTGTTTCAAAATTGTAATGATGG - Intergenic
1118973378 14:70655991-70656013 CTGCTTTGTATATGAAATGAAGG - Intronic
1119016176 14:71057880-71057902 CTTCTTGGAATATGGAATGTGGG - Intronic
1124166065 15:27326986-27327008 CTCCTCCGGATTTGGAATGACGG + Exonic
1124876710 15:33601565-33601587 ATGCTTGGCATTTGGAATGGTGG - Intronic
1126303651 15:47229157-47229179 CTGATTCTAGTTTGAAATGAAGG - Intronic
1131334366 15:91533454-91533476 CTGCTTGGAATTTTAAATGGAGG + Intergenic
1134283532 16:12839354-12839376 CTGCTTCCAAAATGCAATGATGG - Intergenic
1142941236 17:3381388-3381410 CTGCTTTGAATTGGGCAGGAAGG - Intergenic
1143674652 17:8423027-8423049 CTGCTTCGAAATTACAAGGAGGG - Intronic
1146696743 17:34914388-34914410 CTGTTTCCAAATGGGAATGATGG - Intergenic
1150582604 17:66488694-66488716 CTGCTTAGAATTGGGAATACTGG + Intronic
1151828396 17:76536233-76536255 CTGCTTCTGAGTTGGAATCAGGG + Intronic
1154264047 18:12864073-12864095 CTACTGCCAATTTGGTATGAGGG - Intronic
1159712637 18:71781294-71781316 ATGCTTAGGATTTGGAATCAAGG - Intronic
1165483840 19:36083333-36083355 CTGCTGCCCATTGGGAATGAGGG + Intronic
1165987034 19:39778424-39778446 CTGCTAGGAGTTTGGGATGATGG - Intronic
1166367864 19:42286366-42286388 CTGCTGGGAATGTGGCATGACGG + Intronic
929393340 2:41496077-41496099 CTCCTTCCTATTGGGAATGATGG - Intergenic
932151692 2:69378944-69378966 CTACTTTGAATTTTTAATGATGG - Intronic
936836228 2:116712395-116712417 CTGCCTCTAATTTTGAATTAAGG - Intergenic
940788446 2:158006502-158006524 CTGCTTCATATTGGGAATTATGG - Intronic
947094657 2:226552064-226552086 CAGTTTGGAATTTGGAATGCAGG - Intergenic
948202064 2:236136480-236136502 CTGGCTGGAATTTGGAAGGAGGG - Intergenic
1172754004 20:37270807-37270829 CTGCTTCTAGTCTGGAGTGAGGG - Intergenic
1173663991 20:44752565-44752587 CTGCTTTGAAATGGGGATGACGG + Intronic
1175088181 20:56478837-56478859 CTGATTCCAATTTTGAAAGAAGG - Intronic
1180148889 21:45937621-45937643 CTTCTTTGAATTTGCAATGGAGG + Intronic
955721496 3:61886167-61886189 CTGATTTGAAATTGGAAGGAAGG - Intronic
965129995 3:164685216-164685238 CTTCTTCCAATCTGGATTGATGG + Intergenic
966267076 3:178059302-178059324 GTTCTTTGAATTTGGAAAGAGGG + Intergenic
966548256 3:181175542-181175564 CTCTTTTGAATTTGGAAGGATGG + Intergenic
973086273 4:46065385-46065407 CTGCTTCGAATTTGGAATGATGG - Exonic
973104207 4:46312517-46312539 TTGCTTCGAATTCAGGATGATGG - Exonic
973802206 4:54489971-54489993 CTTCTTCAAACTTGGAATAATGG - Intergenic
974151860 4:58020452-58020474 CTTCTGGGAATTTGGAATCATGG + Intergenic
975088307 4:70369880-70369902 GTTCTTCAAAGTTGGAATGATGG + Intergenic
991283965 5:64948918-64948940 CTGCTTCTACTATGGAATCAAGG - Intronic
993076937 5:83243865-83243887 CTGCTTGTAATTAGGAATGCCGG - Intronic
995332821 5:110964733-110964755 CTTCTTAGACGTTGGAATGATGG - Intergenic
999304046 5:150508408-150508430 CTGCTTCTGATCTGGAATGAAGG - Intronic
1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG + Intronic
1000504472 5:162097815-162097837 ATGCTGAGAATTTGGAATGATGG + Exonic
1001464039 5:171946522-171946544 CTGGCTGGAATGTGGAATGAGGG - Intronic
1007684360 6:43656407-43656429 CTGGTCCGAGTTTGGACTGAGGG + Intronic
1008907071 6:56690299-56690321 CTGCTTTGGAATTGGAATAATGG - Intronic
1009830814 6:68930551-68930573 GTCTTTAGAATTTGGAATGATGG + Exonic
1009863914 6:69371944-69371966 CTGGTTAGAATTTGGTAGGAAGG + Intronic
1010437213 6:75846457-75846479 CTGCTTAGAATTTTAAATAATGG - Intronic
1013216324 6:108030823-108030845 CTGCTTTGAAGTTGGGTTGAAGG - Intergenic
1014673433 6:124335476-124335498 TTGCTTTGAATTTGAAATGAAGG + Intronic
1019115314 6:169755939-169755961 CTGCTTTGAATTTGGAGTGAAGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1028736046 7:94213557-94213579 TTGATAGGAATTTGGAATGAAGG - Intergenic
1033619723 7:143051346-143051368 CTGCTTCGTGTTTGCAAAGATGG - Intergenic
1033930070 7:146509396-146509418 ATGCTTCGCCTTTGGGATGAGGG - Intronic
1034097255 7:148421301-148421323 CTGATCCTTATTTGGAATGAGGG + Intergenic
1035380172 7:158432978-158433000 CAGCCTGGAATTTAGAATGATGG - Intronic
1037616571 8:20524497-20524519 CTGCTTGGAATTTGGCTTGTTGG + Intergenic
1041726227 8:61020088-61020110 CTGCCTCTATTTGGGAATGAAGG + Intergenic
1043312997 8:78885934-78885956 CTCCTTGGAATTTGGAATGGGGG + Intergenic
1052178427 9:25494850-25494872 CTCCTTCGAAATAGGAATTAAGG + Intergenic
1052552669 9:29970360-29970382 CTGCTTCCAAGTTGGAGGGACGG - Intergenic
1056461838 9:86816426-86816448 CTGATTAGAATTTGCACTGAGGG + Intergenic
1061703777 9:132436684-132436706 CAGCTTCAAATGTGGAATGGTGG - Intronic
1061836068 9:133331246-133331268 CTGCTCAGAATTTGGAGGGAGGG - Exonic
1187760842 X:22582370-22582392 CAGCTTAGAGTTTTGAATGATGG - Intergenic
1192698396 X:73442967-73442989 ATGCTTAGCAATTGGAATGAAGG - Intergenic
1195650175 X:107275466-107275488 CTGCTTGGAAGTTGGGAGGATGG + Intergenic