ID: 973086586

View in Genome Browser
Species Human (GRCh38)
Location 4:46070153-46070175
Sequence CAGGGTCAATCATTGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973086586 Original CRISPR CAGGGTCAATCATTGGAAAT TGG (reversed) Intronic
902289672 1:15427885-15427907 CAGGGTTCATCAGTGGAACTGGG + Intronic
907662695 1:56407759-56407781 CAAGGTCAATCACGGGAAAGAGG - Intergenic
907866369 1:58403151-58403173 CAGGGACAGTCTTTGGACATTGG - Intronic
909650066 1:77965093-77965115 CAGGATTAGTCATTGGAAAAGGG - Exonic
910538949 1:88332756-88332778 CATGCTGAATCATTTGAAATTGG - Intergenic
912921755 1:113875078-113875100 CAGGGTCATTGATTTGATATGGG + Intergenic
913369863 1:118086179-118086201 CAGGGGAAATCAATGGTAATTGG + Intronic
918652058 1:186977634-186977656 AAGGATCAATCTTTGGAAAGGGG - Exonic
919562676 1:199141416-199141438 CAGGGGCAATCACTGGACAGTGG - Intergenic
1063561475 10:7132145-7132167 AAGAGTGAATGATTGGAAATAGG - Intergenic
1065258788 10:23902976-23902998 CAGGGTGTAGCGTTGGAAATGGG + Intronic
1069893717 10:71667673-71667695 CAGGGCAAATCAATGGAAAAGGG + Intronic
1070922131 10:80194650-80194672 CAGGCGCACTCATTGAAAATAGG - Intronic
1074329240 10:112487449-112487471 CAAGGTTTATCATTGGCAATTGG + Intronic
1077928097 11:6702498-6702520 TAGGGTCAAGCATTGGAATGAGG + Intergenic
1078556368 11:12330029-12330051 CAAGGACAATCATGGGAAAAAGG - Intronic
1087684429 11:101247259-101247281 TATGGTCAAACATTGAAAATTGG + Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089333842 11:117709146-117709168 CAGGGTCACACATTGAAACTAGG - Intronic
1092665994 12:10798768-10798790 CAGAGTCAATGATTGGGACTAGG + Intergenic
1097493368 12:60297321-60297343 CAAGCTCAACCACTGGAAATGGG + Intergenic
1101259802 12:103017379-103017401 CAGGGTCAATAATTTAGAATGGG + Intergenic
1103043943 12:117719606-117719628 CAGGGTCAATGATTTACAATAGG - Intronic
1106541104 13:30690942-30690964 CAGGATCAATGAGGGGAAATGGG - Intergenic
1109372234 13:61437725-61437747 CTGAGTCAATCGTTGGAAATAGG + Intergenic
1116248310 14:42447360-42447382 CAGTGTCAATGATTGGAGAAGGG - Intergenic
1117437489 14:55730677-55730699 CAGGGTCAATCCTTTTAAGTGGG + Intergenic
1117825476 14:59697803-59697825 CAGGTTGAATCAGTAGAAATTGG + Intronic
1120135274 14:80859751-80859773 CAGTGTTAATCATTGGAAATTGG - Intronic
1120884674 14:89442387-89442409 CAGGTTCAATCTTGGGAAACAGG + Intronic
1127270927 15:57401297-57401319 CAGAGTTAATTACTGGAAATAGG + Intronic
1130737799 15:86568821-86568843 AAGGGTCAAGCATAGGAAGTTGG + Intronic
1135871663 16:26156838-26156860 CAGAATCCATCATTGCAAATTGG + Intergenic
1140540924 16:75755776-75755798 TAGGGTCAGTCATGGGAAATTGG + Intronic
1155046557 18:22108591-22108613 CAAGGAAAATCTTTGGAAATGGG - Intergenic
1155213854 18:23625201-23625223 AAGGGACAATCATAAGAAATAGG - Intronic
1155728396 18:29118805-29118827 CAGGGCCATTCAGAGGAAATGGG - Intergenic
1160618625 18:80153483-80153505 CTCGGTCAAACATTGGAATTAGG - Intronic
1160723754 19:608648-608670 CAGGGTCAGTCTTTGGACATCGG + Intronic
1164887688 19:31796658-31796680 CAATATCAAGCATTGGAAATAGG + Intergenic
1165283229 19:34815631-34815653 CAGAGTCCATGAATGGAAATGGG - Intergenic
926489707 2:13509199-13509221 TAGGGTAAATCATTTCAAATAGG - Intergenic
930586601 2:53274981-53275003 CAGGATGAAACATTTGAAATAGG - Intergenic
931929552 2:67115048-67115070 CAGGGTAAATAATTAGGAATAGG + Intergenic
932844170 2:75117928-75117950 CAAGTTGAATCTTTGGAAATGGG + Intronic
934471860 2:94552053-94552075 TAGAGTCCTTCATTGGAAATGGG - Intergenic
936631239 2:114205381-114205403 AAGGGAAAATCACTGGAAATGGG + Intergenic
936741514 2:115516936-115516958 CAGGGTTAATCTTTGCCAATAGG - Intronic
939620826 2:144416835-144416857 TAGGGTCAAATATTGGAGATAGG - Intronic
940051064 2:149465277-149465299 CAGGGTCAGACATGGGAAAAGGG + Intronic
940221546 2:151357238-151357260 CAGTGTCAATTATGGGATATGGG - Intergenic
941789782 2:169539176-169539198 GAGGATCAATCACTTGAAATGGG + Intronic
942960934 2:181829302-181829324 CAGAATCAATCACTGGATATAGG + Intergenic
943078706 2:183230522-183230544 TAGGGTCCATCAGTGGAGATTGG + Intergenic
948806334 2:240454882-240454904 CTGGGTCCATCATTGGGGATGGG + Intronic
1168934613 20:1653251-1653273 CAGGCTCACTCATTGGTAACTGG - Intronic
1168937726 20:1681366-1681388 CAAGGTCATTCATTGGTAATTGG - Intergenic
1169650130 20:7857871-7857893 GAGGGTCAGTGATAGGAAATAGG + Intergenic
1177319600 21:19503627-19503649 CAGGAACATTCATTGGAAAAAGG - Intergenic
1185143771 22:49118319-49118341 CAGCGGCAATCATTGGAGATCGG + Intergenic
1185250600 22:49799675-49799697 CAGGTGCTATCAATGGAAATGGG - Intronic
953682750 3:45051996-45052018 CAGGGGCAGTCATTGGACAGTGG - Intergenic
955252270 3:57295815-57295837 CATGGACAATCATTAAAAATTGG - Intronic
956293304 3:67684652-67684674 CATGGTGAATTATTGAAAATTGG - Intergenic
956850455 3:73223859-73223881 CAGGGTCAATCCCAGGAAACAGG + Intergenic
958446952 3:94227172-94227194 CAGGGTCAATCAGGGGACAAAGG + Intergenic
960001438 3:112735671-112735693 CAGGGTCCCTCATTGAAACTTGG + Intergenic
965011116 3:163092902-163092924 AAGTGACAATCATTGAAAATTGG - Intergenic
966826058 3:183965997-183966019 CAAGGTCCATCATTGGTAAATGG - Intronic
967252143 3:187551306-187551328 GAGGGTTTAACATTGGAAATGGG - Intergenic
969834172 4:9825821-9825843 CAAGGTCAAATATTGGAAACAGG + Intronic
970790003 4:19846007-19846029 CAGGGTCAATGGCTGGCAATAGG - Intergenic
970903359 4:21186134-21186156 CAGGGTAAATCTTTGTAAAAGGG - Intronic
973086586 4:46070153-46070175 CAGGGTCAATCATTGGAAATTGG - Intronic
973598863 4:52521241-52521263 CAAGGTCATACACTGGAAATGGG - Intergenic
978352897 4:107838995-107839017 CAGAATCAATCACTGGCAATTGG - Intronic
982470300 4:155781426-155781448 CAGGGTCATGAATTGGATATTGG - Intronic
985752946 5:1692827-1692849 CAGAGACTATCATTGGACATTGG - Intergenic
985796225 5:1964117-1964139 CAGGGTCAGTCAGTGGGATTTGG - Intergenic
985962117 5:3310473-3310495 CAGGTCCAATCTTTGTAAATGGG + Intergenic
986005174 5:3661482-3661504 CTGTGACAATCATTGGAATTAGG - Intergenic
988232293 5:28495176-28495198 CAGGGACAAACAATGGAATTTGG - Intergenic
988861579 5:35286295-35286317 CAGGGACAATGATTTGAAATGGG + Intergenic
990016593 5:51069988-51070010 AAGGCTTAATCATTAGAAATAGG - Intergenic
990689091 5:58342698-58342720 CTGGTTCCTTCATTGGAAATGGG - Intergenic
994110328 5:95995810-95995832 CTGGGTCATGCATTGGATATAGG - Intergenic
995071079 5:107922562-107922584 CAGCGTCAATCTTAAGAAATTGG - Intronic
995828057 5:116323530-116323552 AAGGGTCAAGCCTTAGAAATGGG + Intronic
997242812 5:132320491-132320513 CAGGCCCTATCCTTGGAAATGGG + Intronic
998456737 5:142279758-142279780 CATGGTCCATCTTTGGACATTGG - Intergenic
1000546141 5:162605331-162605353 CAGGGTGAAAGATTGGATATGGG + Intergenic
1006899633 6:37491514-37491536 CAGGGTCAGGCAGTGGTAATGGG + Intronic
1007993831 6:46285287-46285309 CAGGCTCCATCTCTGGAAATAGG - Intronic
1008858729 6:56123485-56123507 TTTGGTCAATCATTGGACATAGG - Intronic
1017082817 6:150685103-150685125 CAGTGTCACTCATTGGAGACAGG - Intronic
1024248774 7:47490689-47490711 CAGTGCCAATCGTTGGAAATGGG + Intronic
1028488255 7:91383633-91383655 CAGGGTCAATGAATAGACATTGG + Intergenic
1028522909 7:91752343-91752365 CAGGTTCTGTCATTGGAACTAGG + Intronic
1028582032 7:92418527-92418549 CAGGGTAAATTATTAGCAATGGG - Intergenic
1041936128 8:63333723-63333745 CAGTGTCAAACATTAAAAATGGG + Intergenic
1045773159 8:105769334-105769356 CAGAGTCAATCAAAGGAAAACGG - Intronic
1051875386 9:21787701-21787723 CAGAGTCTAGCATTGGAAACAGG - Intergenic
1053295776 9:36911994-36912016 CAGTGTCTATCATTGGAAGCAGG - Intronic
1055376296 9:75651396-75651418 CAAGGTGAATCCTTGGAATTTGG + Intergenic
1058096020 9:100861275-100861297 CGGGGTCATTCATGGGACATGGG - Intergenic
1191608105 X:63083294-63083316 CAAGCTCAATCATTGGCAATGGG + Intergenic
1193358578 X:80552993-80553015 CTGGGCCAATGATTGGACATAGG - Intergenic
1194460513 X:94161609-94161631 GAGGGTCATTTATTGGAAAGTGG - Intergenic