ID: 973086686

View in Genome Browser
Species Human (GRCh38)
Location 4:46071672-46071694
Sequence GACCATGTAGACTAATGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973086681_973086686 29 Left 973086681 4:46071620-46071642 CCTTCTAGTGGGACAAGATGTGG 0: 22
1: 261
2: 437
3: 433
4: 415
Right 973086686 4:46071672-46071694 GACCATGTAGACTAATGTGTAGG 0: 1
1: 0
2: 1
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973086686 Original CRISPR GACCATGTAGACTAATGTGT AGG Intronic
901343677 1:8519010-8519032 GAACATCTAGACTCAGGTGTGGG - Intronic
902384336 1:16067880-16067902 AACCATGGTGACTAATGGGTTGG - Intronic
908213458 1:61925370-61925392 GACCATTTAGAGTTATTTGTTGG - Intronic
912848487 1:113099670-113099692 GAGAAAGTAGAGTAATGTGTTGG + Intronic
913677083 1:121150990-121151012 TACAATGTTGGCTAATGTGTTGG - Intergenic
914028918 1:143938618-143938640 TACAATGTTGGCTAATGTGTTGG - Intergenic
918769988 1:188544939-188544961 GACCGTGTAGAGAAATGTGGTGG + Intergenic
920464383 1:206169507-206169529 TACAATGTTGGCTAATGTGTTGG - Intergenic
924676395 1:246182565-246182587 GTCCAGGTAGACTGTTGTGTGGG - Intronic
1063365003 10:5485307-5485329 GACCAGGAAGACCCATGTGTCGG - Intergenic
1067945753 10:50687027-50687049 GACCATGGAGAAGAAGGTGTTGG - Intergenic
1069703900 10:70445108-70445130 CACCATGTGGCCTAGTGTGTAGG + Intronic
1073701954 10:105936522-105936544 AACCATTTAGTCTAAAGTGTAGG - Intergenic
1080071565 11:28095063-28095085 GAAGATGAAGACTAATCTGTAGG - Intronic
1080563577 11:33487266-33487288 GATCATGGAGACTAATTTGGAGG + Intergenic
1082962340 11:58930737-58930759 GACAAGGTATACTAATGAGTAGG + Intronic
1085341106 11:75732207-75732229 AACCAGGAAGACTCATGTGTGGG + Intronic
1089356370 11:117856592-117856614 AACCATTTAGACTAAACTGTGGG - Intronic
1090271822 11:125391481-125391503 GATCATGTATGCAAATGTGTTGG - Intronic
1098098076 12:66981812-66981834 CACCATGTAGGCAAATGTGAAGG - Intergenic
1104172663 12:126297386-126297408 GACGATGTAGACAGTTGTGTAGG + Intergenic
1105612927 13:21985168-21985190 TACCATGTAGACTTTTTTGTGGG + Intergenic
1108448160 13:50529611-50529633 GACTATGGAGACTGATCTGTTGG + Intronic
1116148753 14:41110317-41110339 GCCCATGTAAACTAAACTGTAGG + Intergenic
1122862068 14:104587237-104587259 GCCCAGGTAGGCAAATGTGTAGG + Intronic
1124904619 15:33857125-33857147 GCCCAAGCAGACTAATGTATAGG - Intronic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1138065404 16:53936062-53936084 GACCATGTTGTCTAATGATTTGG - Intronic
1138418750 16:56886154-56886176 GACCAGGGAGACTAGTGTGGAGG + Intronic
1142894224 17:2963998-2964020 GAGCTTGTAGCCAAATGTGTTGG - Exonic
1150932248 17:69597743-69597765 TATCATGTAGATAAATGTGTTGG + Intergenic
1167927956 19:52837455-52837477 GACAATGTTGACTAAAATGTAGG - Intronic
929716779 2:44319760-44319782 CCCTTTGTAGACTAATGTGTAGG - Exonic
930364074 2:50416897-50416919 AACCATGTAAACTATTGTTTAGG + Intronic
939411864 2:141837819-141837841 GAACATTTAGGTTAATGTGTTGG - Intronic
944780243 2:203010176-203010198 GACCATTTAAATTAATGTGGAGG + Intronic
946992981 2:225356975-225356997 GACCCTGTAGACAATTGAGTGGG - Intergenic
1175070266 20:56327237-56327259 GACCATGGAGACTTATGTTCAGG - Intergenic
956558395 3:70546385-70546407 GAACCCGTGGACTAATGTGTAGG + Intergenic
959593422 3:108103497-108103519 GACAAGGTAAACTAATGAGTAGG + Intergenic
961694795 3:128697137-128697159 GACCATCCTGACTAATGTGGTGG + Intergenic
963837171 3:150069191-150069213 GATCAAGTAGAAAAATGTGTTGG + Intergenic
965028593 3:163334548-163334570 AACCATATAGAATAATTTGTAGG + Intergenic
965360128 3:167728729-167728751 GACTATGCAGAATACTGTGTTGG - Intronic
967537328 3:190622002-190622024 CATCAAGTAGACTAATGTGCCGG + Intronic
969335401 4:6506111-6506133 GACCTTCTAAAATAATGTGTTGG + Intronic
970665096 4:18327673-18327695 GAAGATGTAGAATAATATGTGGG + Intergenic
972158141 4:36190549-36190571 TATCATGTAGACTAATGTATAGG - Intronic
973086686 4:46071672-46071694 GACCATGTAGACTAATGTGTAGG + Intronic
977221507 4:94343017-94343039 TACCTTGTATACAAATGTGTTGG - Intergenic
980194569 4:129572007-129572029 GATCATATAGATTAATGTGTTGG + Intergenic
981635436 4:146873154-146873176 TACCATGTAAACCAATGTGAGGG + Intronic
987501345 5:18713567-18713589 GAGAATGCATACTAATGTGTAGG - Intergenic
992246902 5:74835235-74835257 GACCATGTAGCCCTGTGTGTAGG - Intronic
993887778 5:93436674-93436696 TACCATGTTGACAAATGTATTGG - Intergenic
995761083 5:115562570-115562592 AACCATGTAGACACAAGTGTAGG - Intergenic
996552211 5:124743058-124743080 GACCACATTGACTAATGTTTGGG - Intronic
996928253 5:128855168-128855190 GCCCATGAAGACTAAGGTCTGGG - Intronic
1001847266 5:174933317-174933339 GACAGTGTAGACAATTGTGTGGG - Intergenic
1001918974 5:175585805-175585827 CACCATGTAGACTATTGCGAGGG - Intergenic
1003182615 6:3804982-3805004 AAGCATGTAGTCTAAAGTGTTGG + Intergenic
1004464198 6:15868866-15868888 GACCATGAAGACTGTTATGTGGG + Intergenic
1013044556 6:106471365-106471387 GCACATGTACACCAATGTGTGGG + Intergenic
1016757265 6:147700500-147700522 GACACTGTAAACTACTGTGTTGG + Intronic
1021658211 7:22892895-22892917 GACCATGAACCCTAATGTTTTGG + Intergenic
1023539539 7:41250851-41250873 TACCATTTTGAATAATGTGTGGG + Intergenic
1023627853 7:42134248-42134270 GACCATGTATTCTTATGTCTGGG - Intronic
1024086885 7:45900842-45900864 GACCATGTAGAATATCATGTGGG - Intergenic
1033381664 7:140826599-140826621 TACCATGTAGATTAAGATGTAGG - Intronic
1038612453 8:29069018-29069040 CACCATGGAGACTACTCTGTTGG + Exonic
1046936818 8:119892687-119892709 GAACATGTAGACAAATGTGTTGG - Intronic
1050828871 9:9985902-9985924 AACCATGAAAACTAATGTATAGG + Intronic
1060452825 9:123759262-123759284 GAGCTTGTAGACAAATGTATAGG + Intronic
1186864770 X:13708662-13708684 AATCATGTAGAAGAATGTGTAGG + Intronic
1188573570 X:31618601-31618623 GTCAATGTAGAGTAATGGGTAGG + Intronic
1192690580 X:73358560-73358582 CACCCTGTAGGCCAATGTGTAGG - Intergenic
1192899593 X:75482109-75482131 GATGATGGAGACTACTGTGTTGG + Intronic
1193670262 X:84376106-84376128 GGCCATGTATACAAATGTCTGGG - Intronic
1195800012 X:108698195-108698217 CACCATGTAGAAGAATCTGTGGG - Intergenic
1198642523 X:138772235-138772257 GAACATTTAGCCTAATGTTTAGG - Intronic
1201899104 Y:19028329-19028351 GGCCATGTAGTCTAATGGGGAGG - Intergenic