ID: 973088318

View in Genome Browser
Species Human (GRCh38)
Location 4:46097899-46097921
Sequence AGTTCTTGGAAAAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973088318_973088321 14 Left 973088318 4:46097899-46097921 CCAGCCATCTTTTTCCAAGAACT 0: 1
1: 1
2: 2
3: 24
4: 242
Right 973088321 4:46097936-46097958 ATAATCATCAAATTATCAATAGG 0: 1
1: 0
2: 0
3: 36
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973088318 Original CRISPR AGTTCTTGGAAAAAGATGGC TGG (reversed) Intronic
902215773 1:14933569-14933591 AATTATTGGAAAAAGATACCTGG - Intronic
906094791 1:43215322-43215344 AGGTCTTTGATAAGGATGGCCGG + Intronic
906104880 1:43285737-43285759 AGTTCTTGGCAAAAGCTTGGGGG - Intergenic
906490721 1:46266476-46266498 AGTTCTTGGAGAAAGAGGGAAGG + Intronic
907280930 1:53346632-53346654 ACTTCTTGGCAAACGTTGGCAGG - Intergenic
909115844 1:71535299-71535321 AGTTCATTGAAAAAGACGGGTGG + Intronic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
910964392 1:92793827-92793849 TGTTAATGGAAAAAGATGGAAGG - Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
912456810 1:109803556-109803578 AGGTCTTGGAAAAGGATTGCAGG - Intergenic
915099356 1:153487710-153487732 AGTTCTTGGATAATGGTGGGAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
919105329 1:193142768-193142790 AATTCTTGGAAACAAATTGCTGG + Intronic
919889018 1:201956663-201956685 AGATCTTAGAAAAATAAGGCCGG + Intronic
921638875 1:217528140-217528162 AGTTCATGGAAAATAATGGTTGG + Intronic
922008319 1:221554727-221554749 CATTCTTGGAAAAAGTTGGGTGG + Intergenic
924057799 1:240141205-240141227 AGATCTTTGAAAAAGATGTCAGG + Intronic
924229988 1:241955051-241955073 AGATCTTGGAAACGGAAGGCAGG + Intergenic
1063714838 10:8516297-8516319 AGTTCTTAAAAAAAGGAGGCGGG + Intergenic
1063728453 10:8667377-8667399 GGTTCTTGGAATAACATGCCTGG + Intergenic
1065079819 10:22117277-22117299 AGTTCTAAGAAAAACATAGCAGG - Intergenic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1070342113 10:75507222-75507244 ACTGCTTGGAGAAAGATGGCTGG + Intronic
1071167729 10:82826335-82826357 AGTTCTTGCAACAAGCTGCCTGG + Intronic
1072020958 10:91400996-91401018 TGTTCTTTGACAAAGATGCCAGG + Intergenic
1074919532 10:117993262-117993284 AGTTCAGGGAAATAGAGGGCAGG + Intergenic
1077137573 11:1008837-1008859 AGTTCTGGGAAACAGATGAATGG + Intronic
1078939782 11:15989350-15989372 ACTTCTTGGAAGTAGAAGGCAGG + Intronic
1079090227 11:17475876-17475898 AGGTCTTGGAGAGAGATGGGGGG + Intronic
1079372844 11:19866409-19866431 AATTCTGGGAAAAAAATGACAGG + Intronic
1080810633 11:35701053-35701075 AGTCCTTGGAAGAACAGGGCCGG + Intronic
1083081484 11:60098712-60098734 AATTATTGACAAAAGATGGCTGG - Intergenic
1084145672 11:67263906-67263928 ACCTCTTGGAACAGGATGGCTGG + Intergenic
1084478925 11:69405868-69405890 ATTTCTTTAAAGAAGATGGCCGG - Intergenic
1087372829 11:97306203-97306225 ATTTCCTGGAACCAGATGGCAGG - Intergenic
1087398037 11:97627401-97627423 AGTTCTTGGGAAAAGATGGATGG + Intergenic
1088089427 11:106021401-106021423 AGTGCTTGTAAAAAGTTGCCTGG - Exonic
1088390280 11:109306453-109306475 AGTTTTTGGAAATAAATGTCGGG + Intergenic
1090434383 11:126674685-126674707 AGTTAGTGGAGAAGGATGGCAGG + Intronic
1093220581 12:16415795-16415817 AGATCTTTGAAAAACATGGGCGG - Intronic
1094022769 12:25931645-25931667 AGCTCTTGCAAACATATGGCAGG + Intergenic
1098076796 12:66740038-66740060 AGAGCTTGGATAAAAATGGCAGG - Intronic
1099145298 12:79035883-79035905 TGTTCTTGGAAAGAGAGGCCAGG - Intronic
1099535512 12:83838855-83838877 AGATATTGGAAAGAGATGGTAGG + Intergenic
1100875582 12:98957970-98957992 AGTACTTGTAAATAGATGGGAGG + Intronic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1103369265 12:120406395-120406417 AGTTCTTGGAGGAAAATGGGAGG - Intergenic
1105483038 13:20797308-20797330 ATTACTTGGAAAGAGATGGAGGG - Intronic
1105782046 13:23714312-23714334 AGGTTTTGCAAAAAGATGGTGGG - Intergenic
1105806544 13:23954793-23954815 AGCTTTTGCAAAAAGATGGTGGG + Intergenic
1106305117 13:28502841-28502863 ATTTATTTGAAAATGATGGCTGG + Intergenic
1106368911 13:29112340-29112362 GGTTCCTGGAAAGAGATGGCTGG + Intronic
1107461938 13:40612527-40612549 ATTTCTTTCAAAAAGAAGGCTGG + Intronic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1108167627 13:47709674-47709696 AGCTCTTGGCAAAAGAGGGGAGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1113413477 13:110110124-110110146 AGCGCTTGGAAAGAGACGGCTGG - Intergenic
1113920104 13:113902897-113902919 AGTTCAAGGAAAAAAATGGTTGG - Intergenic
1114613355 14:24056019-24056041 AGTTAATGGAAAAAGAGGACGGG - Intronic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117359401 14:54958429-54958451 AGTTCTTGGAAAAATTTGGCTGG - Intronic
1119593295 14:75910278-75910300 ACCTCTTGGAAAAAAATGCCTGG + Intronic
1119878410 14:78079840-78079862 ATTTCTGCAAAAAAGATGGCTGG + Intergenic
1121497762 14:94408162-94408184 AGTTTTTAGAAAATGTTGGCTGG + Intergenic
1121787260 14:96671455-96671477 AGTTCTAGAATAAAGAGGGCAGG - Intergenic
1122392210 14:101397554-101397576 AGTTTGTGGAAAAAGCTGGCTGG - Intergenic
1125681090 15:41530646-41530668 AGTGCTGGGGGAAAGATGGCAGG - Intronic
1128798971 15:70485098-70485120 AAGTCTTGGGAAAGGATGGCAGG - Intergenic
1129361309 15:75026302-75026324 TGTTCTGGGAAGAAGCTGGCTGG + Intronic
1133759516 16:8787137-8787159 GGTTCTTGGAAATGGATGGCAGG + Intronic
1135628087 16:24013743-24013765 GGTTCTTGGTAAAAGATGAAAGG + Intronic
1143920303 17:10326242-10326264 AGCTCTTGGAACAAGATAACTGG - Intronic
1146604000 17:34242532-34242554 ACTTCTAGGAAAAAGAAAGCTGG - Intergenic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148766597 17:50043086-50043108 TGTTCTTAGAAAAAAATGTCAGG - Intergenic
1150354302 17:64470043-64470065 AGTTCTGGAAAAAAGATGGAAGG + Intergenic
1153821116 18:8832806-8832828 AGTCCTTAGGAAAAGATGGAGGG - Intergenic
1155017471 18:21859422-21859444 TTTTCTTGGTAAGAGATGGCTGG + Intronic
1155069684 18:22303596-22303618 GGTTCTTGGATAAGGATAGCTGG - Intergenic
1159285717 18:66347709-66347731 AGTTTTTGGACAGAGATGGGTGG - Intergenic
1159465539 18:68778276-68778298 AAATCTTAGAAAAAGATGGATGG - Intronic
1159689110 18:71463234-71463256 AGTTCTTGAAAATATATTGCAGG - Intergenic
1162524495 19:11199535-11199557 AGTTCCTGGAAAAAGAATGAGGG + Exonic
1162896116 19:13765463-13765485 AGTGGGGGGAAAAAGATGGCAGG - Intronic
1164136372 19:22420482-22420504 ATTTCTTGGAGACAGATTGCTGG - Intronic
1165226811 19:34360661-34360683 AGTCCTAGGAAAAAGGTGGAGGG - Intronic
1165352764 19:35285104-35285126 AGGTCTTGGAATAAAATGGCTGG + Exonic
926748656 2:16180996-16181018 AGTCCTTAGAAAGAGAAGGCAGG - Intergenic
927657569 2:24963647-24963669 TGTTCTTGGGATAAGAAGGCAGG - Intronic
928236833 2:29549602-29549624 AGTTATTGGAAAAATATGTTTGG + Intronic
930178517 2:48326144-48326166 AGATCTTGGGAGAAGAAGGCCGG - Intronic
930374181 2:50543150-50543172 GGTTCCTGGAAAAAGATAGAGGG - Intronic
930815381 2:55591437-55591459 AGTATTTGGAAAAAGTAGGCTGG - Intronic
935287956 2:101581922-101581944 AGTTGTTGGAAAAGGAGGTCTGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935914612 2:107935745-107935767 AGTTCTTTAAAAGAGAGGGCTGG + Intergenic
937714989 2:125022043-125022065 AGATTTTGGAAAAAGATACCTGG - Intergenic
939632719 2:144544660-144544682 AGTACTTGGGAAAAAATTGCTGG - Intergenic
940084945 2:149848676-149848698 AGTTTTGGGAAAGAGATGGCAGG + Intergenic
942031859 2:171970902-171970924 AGTACTTGAAAAAATGTGGCCGG + Intronic
943990413 2:194682736-194682758 AATTGTTGGGAAAAGATGGAAGG + Intergenic
944122398 2:196254168-196254190 AATTCTTGGTACAAAATGGCTGG + Intronic
944631469 2:201630275-201630297 ATTTCTTAGGAAAAGATGTCAGG + Intronic
947125486 2:226864209-226864231 ATTTCTTTGAAAAAAATGGAGGG + Intronic
1170698552 20:18682710-18682732 ATTTTTTGGACACAGATGGCTGG + Intronic
1170757376 20:19216288-19216310 ACTTCTGGAAAAAAAATGGCTGG - Intronic
1171464721 20:25319498-25319520 ACTTCCTGGAAAAAAGTGGCAGG - Intronic
1175048427 20:56129277-56129299 AGTTTGTCCAAAAAGATGGCAGG - Intergenic
1176695551 21:9972797-9972819 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1178239309 21:30880973-30880995 AGATCCTGGAAACAGCTGGCAGG + Exonic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180785396 22:18544254-18544276 AGGTCTAGGAAAACGATGACAGG + Intergenic
1181076791 22:20383907-20383929 AGTTTTATGAAAAAGATGGAAGG - Intronic
1181128975 22:20718295-20718317 AGGTCTAGGAAAACGATGACAGG + Intronic
1181242299 22:21483607-21483629 AGGTCTAGGAAAACGATGACAGG + Intergenic
1185004491 22:48267774-48267796 CGTTCTAGGAAAAGGATGGCAGG - Intergenic
1185363655 22:50424271-50424293 AGTTCTGGGACTAAGATTGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950431077 3:12951625-12951647 AGTTCTAGGAGAATGATGCCTGG + Intronic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
952344853 3:32473841-32473863 AGTTCAAGGAAATAGATGGGTGG + Intronic
953099785 3:39812769-39812791 AGAGCTTGGGAAAAGATGGTAGG - Intronic
955262511 3:57407520-57407542 TGTTCTTGGAAATGGATGGAAGG + Intronic
956301082 3:67773462-67773484 AGGACTTGGAAAAGGCTGGCAGG + Intergenic
956514425 3:70031080-70031102 AGTTCTTGTAAAAAGGTTGATGG + Intergenic
956630727 3:71314228-71314250 AGTTCTTAAAAATAGCTGGCTGG + Intronic
956676945 3:71744267-71744289 ATTTATTGAAAAAATATGGCAGG + Intronic
956925797 3:73986980-73987002 ACCTCATGGTAAAAGATGGCTGG + Intergenic
958984772 3:100767550-100767572 ATTTGTTAGAAAAAGATGGAAGG + Intronic
959258373 3:104043361-104043383 AGTTCTTGGCAACAGACAGCCGG - Intergenic
961461189 3:127051385-127051407 TGTTTTGGGGAAAAGATGGCAGG - Intergenic
963639556 3:147841850-147841872 AGTTTTTGGAAACACATGGAAGG - Intergenic
964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG + Intergenic
964680261 3:159330754-159330776 AGTTCTTTTAAAAAGTTGTCTGG - Intronic
966819387 3:183913200-183913222 ATTTGTTGGAAACAGAAGGCAGG - Intergenic
967360262 3:188622726-188622748 ACTTTTTGGAAAAAGAGAGCTGG + Intronic
967399542 3:189045457-189045479 AGCTCTTGGAATTAGATGTCTGG + Intronic
968186871 3:196639155-196639177 AATTCTTGGCAAGAGCTGGCAGG + Intergenic
969250229 4:5962940-5962962 AGTACTTGTAAAAAGATGGGAGG - Intronic
969623649 4:8291594-8291616 AGGTCTTGGGCACAGATGGCAGG - Intronic
969798570 4:9544723-9544745 CGTATTTGGAGAAAGATGGCAGG - Intergenic
970112936 4:12658956-12658978 AGGTCTTGGAAAAATAGGGAAGG + Intergenic
971153148 4:24055301-24055323 ACTTCTTGAATGAAGATGGCTGG - Intergenic
972191336 4:36594737-36594759 AGTGCTTAGAAAAAAATGACTGG + Intergenic
973088318 4:46097899-46097921 AGTTCTTGGAAAAAGATGGCTGG - Intronic
973934790 4:55833051-55833073 ACTTCTTGGCAAAAGAATGCTGG + Intergenic
974592908 4:63977492-63977514 AATTCTTAGAAAAACATGCCAGG - Intergenic
975609265 4:76188397-76188419 TGTTTTTGGAAAAAGATGATGGG - Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
978107407 4:104920022-104920044 AGTCCTTGCAGAAAGGTGGCTGG + Intergenic
978644249 4:110910097-110910119 TGTTCTCTGAAAAATATGGCAGG - Intergenic
980368177 4:131833045-131833067 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
980982438 4:139666005-139666027 AGTTCCGTGAGAAAGATGGCCGG + Exonic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
982038115 4:151366990-151367012 AGTTTTCAAAAAAAGATGGCAGG + Intergenic
983355836 4:166656295-166656317 AGGTCTAGGAAACAGATGTCTGG + Intergenic
984752515 4:183291816-183291838 AGTTCTTTGAAAAAAATGAAAGG + Intronic
984894932 4:184529982-184530004 AGTATTTGGAAAAAAATGGATGG + Intergenic
985059100 4:186058325-186058347 ATTTCTTGGGTCAAGATGGCAGG - Intergenic
986231379 5:5867396-5867418 ACTGCATGGAAAAAGAGGGCAGG - Intergenic
986805773 5:11307458-11307480 ACTTCTTGTAAAAATATGACAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988072635 5:26313829-26313851 AGATCTTTGAAAAAGATTGTAGG + Intergenic
988410841 5:30884052-30884074 AGTCCTTAGAAACAGTTGGCAGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991982156 5:72243478-72243500 AGTACTTAAAAAAAGAGGGCAGG + Intronic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992850932 5:80806904-80806926 CGTTCTTGGAAACTGCTGGCTGG + Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
994057038 5:95428699-95428721 AGTTCTTGGAAAGAGTTTCCAGG - Exonic
995079400 5:108030802-108030824 AGGTGTTTGAAAGAGATGGCAGG + Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995836063 5:116400813-116400835 AGAGCCTGGAAAAGGATGGCTGG + Intronic
996031140 5:118705037-118705059 TGTTCTTGGAAACAGATATCTGG - Intergenic
996203853 5:120706804-120706826 ACTTCTTGGAGAAAAAAGGCAGG + Intergenic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
996807048 5:127467861-127467883 AGTTCAGGGAAGAAGATGGTGGG - Intergenic
997698209 5:135878108-135878130 AGCTCTGGGTAAAAGCTGGCAGG + Intronic
999963176 5:156778903-156778925 AGTTCTTAGAAAAACGTAGCAGG + Intergenic
1000068129 5:157714194-157714216 AGGGCTTGGAAAAAGATGTTAGG - Intergenic
1000621897 5:163495366-163495388 AGGTGTTGGAAAATGATGGAAGG - Intergenic
1001156438 5:169276373-169276395 AGCTCTTGGAAGAAGATGGGAGG - Intronic
1001601207 5:172929889-172929911 AGTTCTTAGAAAAAGATGGCTGG + Intronic
1003330555 6:5125057-5125079 AGTTCTTGTATGAAGATGACTGG - Intronic
1003752027 6:9069683-9069705 AGGTCTTTGACAAGGATGGCAGG - Intergenic
1005515929 6:26554105-26554127 ACTTCTTGGAGACAGGTGGCCGG + Intergenic
1005921166 6:30403142-30403164 AGGTCTTGAAAATAGATAGCTGG + Intergenic
1006431961 6:34002624-34002646 AGCTCTGGGCAAAAGCTGGCTGG - Intergenic
1007773874 6:44213083-44213105 AGCTCTTGAAAAGAGATTGCTGG + Intergenic
1010899283 6:81406066-81406088 AGTCTTTTGAAAAATATGGCAGG + Intergenic
1012773239 6:103468784-103468806 GTTTCTTGGAAATAAATGGCTGG + Intergenic
1013715565 6:112956834-112956856 GTTTCTTGGAAAGAGAAGGCTGG + Intergenic
1013840166 6:114382000-114382022 GGTTCTTGGGAAAAGATAACAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1016489647 6:144583327-144583349 GGTTCTAGGAAAAAGGAGGCTGG - Intronic
1016846621 6:148574452-148574474 AGTTGTTGGAAGAAGCAGGCAGG + Intergenic
1021188145 7:17589392-17589414 AGCTGTTGGAAAAACATGGCAGG + Intergenic
1022020125 7:26391317-26391339 ATTTCTTTAAAAAAGTTGGCTGG - Intergenic
1022067325 7:26872561-26872583 CGTTCATGGAAAAAGATGGGTGG - Intronic
1023272990 7:38486537-38486559 AGCTCTTCCAAAAAGATTGCAGG + Intronic
1023981207 7:45071411-45071433 AGGTCTTGGGAAAGGCTGGCAGG - Intronic
1024638928 7:51314711-51314733 ATTTCTTGGACAAAGATGTTCGG + Intronic
1024861215 7:53843910-53843932 AGTTTTGGGATAAAGATGGAGGG - Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025815334 7:64905495-64905517 ATTTCTTGGAGACAGATTGCTGG + Intronic
1025865326 7:65375498-65375520 ATTTCTTGGAGAAACATTGCTGG + Intronic
1025922768 7:65929110-65929132 AGTTTTTGAAAAAAGAGGGCTGG + Intronic
1028330636 7:89586847-89586869 AGTTATTGGGAAATCATGGCAGG - Intergenic
1030894186 7:115037185-115037207 AGTTCTTGAAAAATGATTTCAGG + Intergenic
1032298669 7:130667775-130667797 CATTCATGGAAAAAGAGGGCAGG - Intronic
1033631177 7:143159561-143159583 AGTTCTTGACAAAGGATGCCTGG - Intergenic
1033823664 7:145163385-145163407 CGTTCGTAGAAAAAGCTGGCAGG - Intergenic
1036435433 8:8728979-8729001 AGTGCTTGCAAAAAGGTGGGAGG - Intergenic
1036581050 8:10076408-10076430 AGTTCTCCCAAAAAGAAGGCTGG - Intronic
1036660681 8:10706502-10706524 AGCTCTAGGTAAAAGTTGGCTGG + Intronic
1036700120 8:11007896-11007918 AGCCCTTGGAAGCAGATGGCAGG + Intronic
1037092432 8:14938855-14938877 AATACTTGGAAAAAAATGGGAGG - Intronic
1042212008 8:66390231-66390253 AGTTTTAGGAGAAAGATTGCAGG + Intergenic
1042937281 8:74072775-74072797 AGGTCCTGGAAAAAGCTGGGAGG + Intergenic
1043620363 8:82183424-82183446 AGTTTTTGGAAAAAAATAGGAGG + Intergenic
1044002397 8:86899856-86899878 AGTCCTTCCACAAAGATGGCTGG + Intronic
1045378954 8:101603853-101603875 ACTGCTTGGAAATTGATGGCGGG + Intronic
1045919002 8:107507977-107507999 AGTTCTAGATAAAAGATGCCTGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046677786 8:117130819-117130841 AGTGCTTGGAAAAAGAAGTGTGG + Intronic
1047105319 8:121724936-121724958 ATATCTTGGAACAAGATAGCTGG - Intergenic
1048644040 8:136397979-136398001 AGTTTTTGGAAAAAGAGGAGAGG + Intergenic
1051026604 9:12620399-12620421 AGTTTTTGGAAAAAAATAGATGG + Intergenic
1051137908 9:13944027-13944049 ATCTCTTGGAAACAGATGGCAGG + Intergenic
1052047335 9:23809969-23809991 TGTTCTGAGAAAAAAATGGCAGG - Intronic
1052658986 9:31403897-31403919 AGTTCTGGGCAAAACATGACTGG + Intergenic
1052974611 9:34401562-34401584 AGTACAAGGAAAAAGAGGGCTGG - Intronic
1053632534 9:39958748-39958770 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1053773226 9:41504783-41504805 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1053885649 9:42643709-42643731 AGGCTTTGCAAAAAGATGGCGGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054211354 9:62291949-62291971 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1054313629 9:63556903-63556925 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1056119372 9:83472111-83472133 AGTTCTGGGGAAAATAGGGCTGG - Intronic
1056199366 9:84259654-84259676 AACTCTTGGAAAAAGGTGGCGGG - Intergenic
1057300912 9:93881341-93881363 AGTTCTTGGCAACAGACAGCCGG - Intergenic
1058029939 9:100184620-100184642 AGTTCTTGAAAATAGTTGGGTGG + Intronic
1058833923 9:108843956-108843978 AGGTCTTGGAGAGACATGGCTGG - Intergenic
1060128841 9:121075491-121075513 AGTGCGTGGAGAAAGATGACAGG + Intronic
1060229856 9:121818590-121818612 AGTTCTTGGAAGTAGATGGAAGG + Intergenic
1060314571 9:122497247-122497269 AGTTCTTGGAACAAAATTTCAGG + Intergenic
1060607696 9:124931740-124931762 AGTCCTGGGATAAAGAAGGCGGG + Intronic
1185929484 X:4186282-4186304 GGTTCTTTGAAAAAGAGTGCAGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189182757 X:39019012-39019034 GGCTCTTGGAAAAAGAGGGCAGG + Intergenic
1190281686 X:48935175-48935197 GGGTCATGGAAAAATATGGCAGG + Intronic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1195681031 X:107546816-107546838 AGTTGTTGGGAGAAGATAGCAGG + Intronic
1195724285 X:107898193-107898215 AGTACTTGGATAAAAATGTCAGG - Intronic
1196288437 X:113910896-113910918 AGATCTGGAAAAAAGTTGGCCGG + Intergenic
1196307178 X:114117570-114117592 TGTTCTGGGAAAAATATGTCTGG + Intergenic
1196934340 X:120714744-120714766 GGCCCTGGGAAAAAGATGGCTGG - Intergenic
1199204620 X:145134370-145134392 ATTCCTTGGCAAATGATGGCAGG - Intergenic
1199381898 X:147181262-147181284 AGCTTTTGGAAAAAGTTGCCTGG + Intergenic
1200318981 X:155165088-155165110 GGTTCATGGAAAGAGATGGGTGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1202044081 Y:20719483-20719505 AATTATTGGTAAAATATGGCCGG - Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic