ID: 973098053

View in Genome Browser
Species Human (GRCh38)
Location 4:46226768-46226790
Sequence GACAGCTCTTGGCCTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973098050_973098053 4 Left 973098050 4:46226741-46226763 CCTCAGATAACTATTCACCTTTT No data
Right 973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG No data
973098047_973098053 13 Left 973098047 4:46226732-46226754 CCCTGCCATCCTCAGATAACTAT No data
Right 973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG No data
973098049_973098053 8 Left 973098049 4:46226737-46226759 CCATCCTCAGATAACTATTCACC No data
Right 973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG No data
973098048_973098053 12 Left 973098048 4:46226733-46226755 CCTGCCATCCTCAGATAACTATT No data
Right 973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973098053 Original CRISPR GACAGCTCTTGGCCTCCTAC TGG Intergenic
No off target data available for this crispr