ID: 973100253

View in Genome Browser
Species Human (GRCh38)
Location 4:46258788-46258810
Sequence GGGGATTCCTTGAGAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973100249_973100253 19 Left 973100249 4:46258746-46258768 CCTGAAGAATGATTCTGGAGCAT 0: 1
1: 0
2: 1
3: 12
4: 175
Right 973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG 0: 1
1: 1
2: 2
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973100253 Original CRISPR GGGGATTCCTTGAGAAAAAT AGG Intronic
903678522 1:25081976-25081998 GGTTATTCCTTGAGATACATGGG + Intergenic
909105378 1:71399961-71399983 GGGGATTTCTCAAGAAAATTTGG - Exonic
910796073 1:91099140-91099162 GGCCATTCCTTGAGAAACACTGG + Intergenic
913408507 1:118522836-118522858 GGGGATAATTTGAGAAGAATTGG + Intergenic
916031201 1:160878954-160878976 TGAGATTCCTTGAGAAACACAGG - Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918543399 1:185656181-185656203 GGGACTTCCTTAAGAAATATTGG + Intergenic
919208394 1:194448190-194448212 GGGGAAGCCTTGAGAGAAGTAGG - Intergenic
920436456 1:205950080-205950102 TGGGATTCCCTGAGCAAAGTGGG + Intergenic
920794077 1:209121534-209121556 AGGATTTCTTTGAGAAAAATTGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
923364127 1:233243138-233243160 GGGGATTCCTGAAGGAAACTGGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063446301 10:6120002-6120024 TGGGATTCTCTGAGAAGAATGGG - Intergenic
1063669011 10:8084635-8084657 GGGCATCCATTGACAAAAATGGG - Intergenic
1063835708 10:10009388-10009410 GGGCATTCCATGAGAAAAAAGGG - Intergenic
1064175151 10:13068112-13068134 CGGGGTTCCATGAGAAAAACAGG - Intronic
1064927667 10:20587243-20587265 GGTGGTTCCTAGAGAAAATTTGG - Intergenic
1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG + Intergenic
1066660235 10:37731332-37731354 TGGGGTTCCATGAGGAAAATAGG - Intergenic
1068129698 10:52882246-52882268 GGGGCTTCCTTGAGTACAAAAGG - Intergenic
1070182299 10:74025915-74025937 GAGGGATCCTGGAGAAAAATGGG + Intronic
1071230472 10:83580029-83580051 GGGGCTTCCTAGAGAAGAGTGGG + Intergenic
1074346250 10:112689211-112689233 GGGAATACCTTGGGAAAAGTGGG - Intronic
1076701024 10:132272792-132272814 GGCTATTACTTGAGAGAAATGGG - Intronic
1079853215 11:25565152-25565174 CCAGATTCCTTGAAAAAAATTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081294884 11:41373171-41373193 GGGGATTCATTGTGCAAACTGGG - Intronic
1081372900 11:42325763-42325785 TGGGATTCCTAGAGATGAATAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083391829 11:62357049-62357071 AGAGATTCCTGGAGAAAAACTGG + Exonic
1085776915 11:79374997-79375019 GGGAATTCCATGAGAAAGACTGG + Intronic
1086279340 11:85167995-85168017 CAGGATTCCTTGAAAAAACTGGG + Intronic
1087705527 11:101486797-101486819 GGGGATTGCTTCAGCTAAATTGG - Intronic
1091556859 12:1580556-1580578 AGGGATTACTAGAGAAGAATAGG - Intronic
1093431795 12:19093152-19093174 GGGGATCTCTTGAGAAAAATAGG + Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095312571 12:40717782-40717804 GTGGATTACTTCAGCAAAATAGG + Intronic
1098124790 12:67279208-67279230 GGGGTTTGCATGGGAAAAATTGG - Intronic
1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG + Intergenic
1098982656 12:76974200-76974222 GGTTATTCCTTCAGAAAACTGGG - Intergenic
1099465419 12:82980629-82980651 TGTGAGTCCTTTAGAAAAATAGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1103312984 12:120026934-120026956 GGGAATTCCATGGGAAAACTGGG + Intronic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1104136064 12:125940070-125940092 GTGGATCTCTTGAGAAAAGTGGG + Intergenic
1109010678 13:56938226-56938248 GGGAGTACCTTGAGAAAACTAGG - Intergenic
1109281649 13:60363610-60363632 GGGGACTGCTTGAGAATGATTGG + Intergenic
1110141178 13:72131363-72131385 AGGGAATCTATGAGAAAAATGGG + Intergenic
1113498992 13:110758614-110758636 GGGAATTCCCTGGGAAAACTAGG - Intergenic
1116416861 14:44688495-44688517 GGGGATTCCAGAAGCAAAATTGG + Intergenic
1120667887 14:87328687-87328709 TGGGATTCTGTGAGAAAAAAAGG + Intergenic
1125033462 15:35096306-35096328 GGAGATTCCTAGAGAAAAAAGGG + Intergenic
1126309192 15:47296635-47296657 GGGGATTCCTTCAGAAAGATGGG + Intronic
1126336950 15:47595637-47595659 AGGGAGCACTTGAGAAAAATTGG + Intronic
1128517754 15:68353809-68353831 GGGCTTTCCCTGAGAGAAATAGG - Intronic
1128803720 15:70514778-70514800 AGAGATTCCTCAAGAAAAATGGG + Intergenic
1130276958 15:82484743-82484765 GTGGATTTATGGAGAAAAATAGG - Intergenic
1130469322 15:84212104-84212126 GTGGATTTATGGAGAAAAATAGG - Intergenic
1130476812 15:84326648-84326670 GTGGATTTATGGAGAAAAATAGG - Intergenic
1130494953 15:84461482-84461504 GTGGATTTATGGAGAAAAATAGG + Intergenic
1130591616 15:85216723-85216745 GTGGATTTATGGAGAAAAATAGG - Intergenic
1130831684 15:87607636-87607658 GGGGAGTGCTCGAGAGAAATGGG + Intergenic
1131747509 15:95464903-95464925 TGGTATTTCTTGAGAAAAAAAGG - Intergenic
1133577075 16:7102199-7102221 GGGCATTCCCTGAGGAAATTCGG + Intronic
1133767206 16:8846446-8846468 AGGAATTCCATGAGAAAAACGGG + Intronic
1134336029 16:13300399-13300421 GGGCCCTCCTGGAGAAAAATCGG + Intergenic
1134413916 16:14027740-14027762 GGGGATTCCTTATGAAAGTTTGG + Intergenic
1135481939 16:22827929-22827951 GAGGATTGCTTGAGAGGAATTGG - Intronic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1143999503 17:11039735-11039757 GGAGAGTCCCTGAGAAAAGTGGG - Intergenic
1144274959 17:13657425-13657447 GGAGATTCCTGGAAAAAAGTAGG - Intergenic
1147115801 17:38298577-38298599 GGTTATTCCTCCAGAAAAATCGG + Exonic
1148335962 17:46841624-46841646 GAGGATTCCTTGAGGAGAAGGGG + Intronic
1148413875 17:47491042-47491064 GGTTATTCCTCCAGAAAAATCGG - Intergenic
1151021516 17:70622655-70622677 GGGGTTTCCACTAGAAAAATTGG - Intergenic
1151078416 17:71300818-71300840 GGGGATTTATTGAGTGAAATAGG + Intergenic
1151667439 17:75553336-75553358 GGGGATGCCTGGAGACAAAAAGG - Intronic
1154405735 18:14089483-14089505 GGGCATTTCTTGAGTAAAAGAGG + Intronic
1155936654 18:31761613-31761635 GGGTAGTCCTAGAGCAAAATGGG - Intergenic
1156515222 18:37673641-37673663 GGGGCTTCCTCCAGGAAAATTGG + Intergenic
1156793963 18:41017607-41017629 TGGGATATCTTGAGAATAATTGG - Intergenic
1161052510 19:2171888-2171910 GGGGCTTCCTGGAGAAAAGAAGG + Intronic
1162763666 19:12904444-12904466 GGGGATTCCTTATGCAAAAGGGG - Intronic
1162935650 19:13980263-13980285 GGGGCTTCCTTCAGGCAAATGGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926711141 2:15881875-15881897 GGAGATCCCTTGAGAACAAAAGG + Intergenic
927581061 2:24247928-24247950 TAGGATTCCTGAAGAAAAATGGG - Intronic
928638972 2:33277657-33277679 GGGGAGTGCTTTAAAAAAATGGG + Intronic
928693397 2:33824164-33824186 GGGGCTTCCTAGTGGAAAATTGG + Intergenic
930111120 2:47679535-47679557 GAGGAATCAATGAGAAAAATGGG + Intergenic
930616807 2:53602447-53602469 AGGGAGTCCTTGAGAAATGTTGG - Intronic
931189212 2:59983371-59983393 TAGGATTCTTTAAGAAAAATGGG - Intergenic
931344963 2:61437940-61437962 TGGAATACCTTGAGAAGAATTGG - Intronic
932725312 2:74174814-74174836 AAGGAATCCTTTAGAAAAATAGG + Intronic
936989791 2:118350526-118350548 TGGGATTTCATGAAAAAAATAGG + Intergenic
939737769 2:145870158-145870180 GGCCATTTCTGGAGAAAAATGGG + Intergenic
941502675 2:166299360-166299382 GAGAATTTCTTGAGAAAATTTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
943515373 2:188879558-188879580 GTGGACTCCTTGAGAAAATGAGG + Intergenic
945071874 2:205998846-205998868 AGGGATTCCTTGTGGAAATTAGG - Exonic
945110911 2:206358564-206358586 TGGAATACTTTGAGAAAAATTGG - Intergenic
945715737 2:213355828-213355850 GGGGATTCGATTAGAAAAAGAGG - Intronic
945743116 2:213687444-213687466 GGGGTTTGCTGGTGAAAAATTGG + Intronic
945988520 2:216373338-216373360 AGAAACTCCTTGAGAAAAATAGG - Intergenic
947090142 2:226500686-226500708 GGGGATATTTTGAGAAGAATTGG - Intergenic
1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG + Intronic
1169325301 20:4670845-4670867 GGGGATTCAATGGTAAAAATAGG - Intergenic
1169655526 20:7918549-7918571 GGGGATTCCTTGGGGAGAAAAGG - Intronic
1169663574 20:8007618-8007640 GTGGAGTACTTGAGATAAATGGG - Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1172175050 20:32967023-32967045 AGGGATTCCTGGAGAAAGGTGGG + Intergenic
1174732170 20:52928568-52928590 TGGGTTTGATTGAGAAAAATGGG - Intergenic
1177476119 21:21625800-21625822 GGTGATTTCTTGTTAAAAATAGG - Intergenic
1181505832 22:23356449-23356471 GGGGATTCCTTGTGGAAAGACGG - Intergenic
1183243061 22:36672690-36672712 GGTGATGCCTTGGGAAGAATGGG - Intronic
950159066 3:10745876-10745898 GATACTTCCTTGAGAAAAATTGG + Intergenic
951796111 3:26540356-26540378 AAGGAATACTTGAGAAAAATTGG - Intergenic
952195353 3:31069440-31069462 GGGGCTTACTTGAGAAAAGAGGG - Intergenic
955246602 3:57230336-57230358 GTTGCTTCCTTCAGAAAAATTGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963167111 3:142216195-142216217 GGGGATTTCAGAAGAAAAATGGG - Intronic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
967773616 3:193361390-193361412 GGGGGTTGCTTGCTAAAAATGGG + Intronic
967944575 3:194793064-194793086 GGGAATAATTTGAGAAAAATTGG + Intergenic
968256852 3:197282268-197282290 AGAGATTCCTTGAGGTAAATGGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
973937286 4:55860195-55860217 GGAGATTCCTTGAAAAATAAAGG - Intronic
975046898 4:69816507-69816529 GGGAATTTCTAGAGGAAAATGGG - Intronic
975612391 4:76214998-76215020 GGGGAATCCTTTAGCCAAATGGG + Intronic
976060549 4:81123305-81123327 TGGAATTCCTAGAGATAAATGGG - Intronic
976154941 4:82133613-82133635 GAAGATTCCTATAGAAAAATGGG + Intergenic
977653053 4:99491672-99491694 GGGGATTGCTTAAGAGAACTTGG + Intergenic
978257705 4:106712348-106712370 GGGTATTCAATTAGAAAAATAGG - Intergenic
981026095 4:140078346-140078368 GGAGAATGCTAGAGAAAAATAGG + Intronic
981036246 4:140172185-140172207 TGGGATTCTTTGAGATAAAAAGG + Intergenic
981558263 4:146018870-146018892 GGGTATTCCTTAAGAAATCTTGG + Intergenic
981992395 4:150938308-150938330 AAGGATTCCTGGAGAAAAATTGG - Intronic
982369797 4:154622634-154622656 GAGGATTCCTTGAGCCCAATAGG + Intergenic
983346735 4:166536245-166536267 GGGGAACCCCTGAGAAAAAGAGG - Intergenic
984496615 4:180506039-180506061 CTGGATTCCTTGAACAAAATAGG + Intergenic
985187012 4:187328384-187328406 GTAGATTCCTTGAGAAATAATGG + Intergenic
985881365 5:2641258-2641280 AGGGTTGCCATGAGAAAAATCGG + Intergenic
988188424 5:27898519-27898541 GGGCATTCATTGAAAAGAATGGG + Intergenic
990120380 5:52443915-52443937 GGGGAATCTTTAAGAAAAACGGG - Intergenic
990352318 5:54931144-54931166 GGAGATTCCTTGAACATAATGGG - Intergenic
992114257 5:73524166-73524188 GGGGATTCTTTGCTAAAAGTGGG + Intergenic
992709707 5:79439142-79439164 GCGGATTCCTTTAAAAAAAGGGG + Exonic
994709221 5:103246104-103246126 GGGGATGCCATGTGGAAAATTGG - Intergenic
1001928427 5:175656449-175656471 GGTGATTCCTTTAGATAAGTTGG + Intergenic
1003001587 6:2340216-2340238 TGGAATAACTTGAGAAAAATTGG - Intergenic
1004419905 6:15459896-15459918 TGAGCTTCCTTGAGCAAAATGGG + Intronic
1005430514 6:25751921-25751943 GTGGCTTCCTTGAAACAAATGGG - Intergenic
1006900600 6:37498453-37498475 TGGCATCCCTTGAGAAATATTGG - Intronic
1010188665 6:73171345-73171367 TGGGATACTTTGAGAAAGATGGG - Intronic
1011335637 6:86256655-86256677 TGGGATTCTTTGATAATAATGGG - Intergenic
1012232442 6:96776212-96776234 TGAGTTACCTTGAGAAAAATTGG + Intergenic
1015369455 6:132434702-132434724 GGGGAATGTTTGAGAAACATAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016653870 6:146495246-146495268 GGGGATTTTTGGAGAAAAAAAGG + Intergenic
1017716294 6:157216035-157216057 GGGGATTGCGTGTGAAAAGTTGG - Intergenic
1018848627 6:167572243-167572265 GGGGGTTCCTTGAGACACAGGGG + Intergenic
1021693233 7:23250101-23250123 CGGGATTCAATTAGAAAAATTGG - Intronic
1028285310 7:88989481-88989503 GGCTATTCCTTGAGAGAAATAGG - Intronic
1028569258 7:92268268-92268290 GGGGATTTCTCCAGAAAAATTGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032613533 7:133441919-133441941 TGGGATTCCTTGAGCAGAGTTGG + Intronic
1032980747 7:137279607-137279629 GGAGCATCCATGAGAAAAATTGG + Intronic
1033383760 7:140851013-140851035 GGAAATTCCTTGAGAGAAAAGGG + Intronic
1033654461 7:143363070-143363092 GGGGATGCCCTGAGAGAAAGTGG + Intergenic
1033813405 7:145044515-145044537 GGTGATTTGTTGGGAAAAATGGG + Intergenic
1038391937 8:27209970-27209992 GGAGATGGGTTGAGAAAAATAGG - Intergenic
1039074323 8:33676077-33676099 GAGGAACCCTTGAGAAGAATTGG - Intergenic
1040366642 8:46724199-46724221 GTGGAATCCTGAAGAAAAATGGG - Intergenic
1041075860 8:54169120-54169142 AGGGATTACTTGAGATGAATTGG - Intergenic
1041542352 8:58999779-58999801 GGGAATTTCTAGAGAAAATTAGG + Intronic
1041641882 8:60211789-60211811 GGTGGTTGCTTTAGAAAAATTGG - Intronic
1042824512 8:72966475-72966497 GGTGTTTCCCTGAGAAAAATCGG + Intergenic
1043664082 8:82786376-82786398 TGGGAATTCATGAGAAAAATTGG + Intergenic
1043833966 8:85024455-85024477 ATGGAGTACTTGAGAAAAATAGG + Intergenic
1044757179 8:95476272-95476294 GATGATTCCTTAAGAAAAAAGGG + Intergenic
1044797384 8:95917773-95917795 GAGGATTCCTGGAGAAAAGGAGG - Intergenic
1045624212 8:104023576-104023598 GGGAAATACTTGAGAATAATAGG + Intronic
1046373934 8:113350608-113350630 GGGTAATCCTTCAGAGAAATTGG - Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1049279464 8:141736970-141736992 GGGGATTCCTGGAGCAACACAGG - Intergenic
1049559692 8:143303433-143303455 GAGGATCCCTTGAGCAATATAGG + Intergenic
1051539289 9:18196479-18196501 CGGGATTCCTTGATGAAATTTGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057098253 9:92332087-92332109 GGGAATGCTTTGAGGAAAATGGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059100487 9:111466832-111466854 GAGGATTGCTTGGGCAAAATAGG - Intronic
1059619084 9:115983607-115983629 GGGGCTTTCTTAACAAAAATGGG + Intergenic
1060136377 9:121159252-121159274 GGGAATTCCTGGAGAAGAAATGG - Intronic
1061925176 9:133802730-133802752 GGTGATACCATGAGGAAAATGGG - Intronic
1188782799 X:34306186-34306208 GGGAATTCCCTAAGCAAAATTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192005879 X:67211846-67211868 CTGGATTTCCTGAGAAAAATCGG + Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199696049 X:150343236-150343258 GGGGATTACTTGAGACAATCGGG + Intergenic
1200021702 X:153216737-153216759 GTGGATCCCTTGAGAAAAGCAGG + Intergenic